Incidental Mutation 'R4191:Ddx19b'
ID318315
Institutional Source Beutler Lab
Gene Symbol Ddx19b
Ensembl Gene ENSMUSG00000033658
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Synonyms
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111003188-111031751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111011348 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 256 (L256Q)
Ref Sequence ENSEMBL: ENSMUSP00000066806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040241] [ENSMUST00000065784]
Predicted Effect probably damaging
Transcript: ENSMUST00000040241
AA Change: L241Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038551
Gene: ENSMUSG00000033658
AA Change: L241Q

DomainStartEndE-ValueType
Blast:DEXDc 5 44 1e-12 BLAST
low complexity region 45 55 N/A INTRINSIC
Blast:DEXDc 57 99 4e-11 BLAST
DEXDc 111 310 2.94e-42 SMART
HELICc 347 434 2.59e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065784
AA Change: L256Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066806
Gene: ENSMUSG00000033658
AA Change: L256Q

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
Blast:DEXDc 72 114 5e-11 BLAST
DEXDc 126 325 2.94e-42 SMART
HELICc 362 449 2.59e-29 SMART
Meta Mutation Damage Score 0.8927 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Ddx19b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Ddx19b APN 8 111020988 missense probably damaging 1.00
IGL02089:Ddx19b APN 8 111008845 splice site probably benign
IGL02445:Ddx19b APN 8 111008824 missense probably damaging 1.00
IGL02756:Ddx19b APN 8 111011278 splice site probably benign
R0411:Ddx19b UTSW 8 111023964 critical splice donor site probably null
R0483:Ddx19b UTSW 8 111008678 missense probably benign 0.07
R1510:Ddx19b UTSW 8 111015653 missense probably damaging 1.00
R1797:Ddx19b UTSW 8 111012807 missense probably damaging 1.00
R1969:Ddx19b UTSW 8 111008258 missense probably benign 0.00
R1981:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R1982:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R3771:Ddx19b UTSW 8 111020981 missense probably benign 0.03
R4190:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R4193:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R5132:Ddx19b UTSW 8 111022408 missense probably benign
R5435:Ddx19b UTSW 8 111008826 missense possibly damaging 0.67
R8062:Ddx19b UTSW 8 111020979 missense probably benign 0.00
Z1088:Ddx19b UTSW 8 111015575 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGACAGCTGCTGTGCAAATG -3'
(R):5'- TGCCCACTAGATATTATGGTGGC -3'

Sequencing Primer
(F):5'- TGCTGTGCAAATGGCCCAC -3'
(R):5'- GCAGCTTCAGAATGCCTCC -3'
Posted On2015-06-10