Incidental Mutation 'R4191:Piwil4'
List |< first << previous [record 35 of 51] next >> last >|
ID318316
Institutional Source Beutler Lab
Gene Symbol Piwil4
Ensembl Gene ENSMUSG00000036912
Gene Namepiwi-like RNA-mediated gene silencing 4
SynonymsMiwi2, 9230101H05Rik, MIWI2
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14696230-14740733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14715000 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 465 (S465P)
Ref Sequence ENSEMBL: ENSMUSP00000111308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076946] [ENSMUST00000115644]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076946
AA Change: S538P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076213
Gene: ENSMUSG00000036912
AA Change: S538P

DomainStartEndE-ValueType
Pfam:ArgoN 155 300 3.7e-11 PFAM
PAZ 313 450 2.55e-67 SMART
Piwi 614 864 8.98e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115643
SMART Domains Protein: ENSMUSP00000111307
Gene: ENSMUSG00000036912

DomainStartEndE-ValueType
Blast:Piwi 1 59 5e-6 BLAST
Piwi 151 444 6.71e-126 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115644
AA Change: S465P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111308
Gene: ENSMUSG00000036912
AA Change: S465P

DomainStartEndE-ValueType
Pfam:ArgoN 92 245 6.5e-10 PFAM
PAZ 266 403 2.55e-67 SMART
Piwi 541 834 6.71e-126 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128327
Meta Mutation Damage Score 0.2130 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL4 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit male specific-infertility with a progressive loss of male germ cells, reduced testis size, abnormal male meiosis and increased apoptosis of spermatocytes in seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Piwil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Piwil4 APN 9 14703097 missense probably damaging 1.00
IGL00331:Piwil4 APN 9 14715031 splice site probably benign
IGL00848:Piwil4 APN 9 14727411 missense probably damaging 0.98
IGL00920:Piwil4 APN 9 14727437 missense probably damaging 1.00
IGL01583:Piwil4 APN 9 14734487 missense probably damaging 1.00
IGL01690:Piwil4 APN 9 14703095 missense probably damaging 1.00
IGL01763:Piwil4 APN 9 14706266 unclassified probably null
IGL02103:Piwil4 APN 9 14725986 splice site probably null
IGL02898:Piwil4 APN 9 14706287 unclassified probably benign
IGL03037:Piwil4 APN 9 14705012 missense possibly damaging 0.88
IGL03352:Piwil4 APN 9 14725887 missense probably damaging 1.00
PIT4651001:Piwil4 UTSW 9 14708899 missense possibly damaging 0.48
R0453:Piwil4 UTSW 9 14727452 missense probably benign 0.00
R2324:Piwil4 UTSW 9 14736908 missense possibly damaging 0.88
R3236:Piwil4 UTSW 9 14700248 unclassified probably benign
R3408:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3689:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R3844:Piwil4 UTSW 9 14729960 missense possibly damaging 0.54
R4505:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4506:Piwil4 UTSW 9 14725963 missense probably damaging 1.00
R4541:Piwil4 UTSW 9 14718316 missense probably damaging 1.00
R4652:Piwil4 UTSW 9 14712308 nonsense probably null
R4876:Piwil4 UTSW 9 14740465 missense probably benign 0.22
R5027:Piwil4 UTSW 9 14709944 missense probably damaging 1.00
R5479:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R6656:Piwil4 UTSW 9 14709934 missense probably damaging 1.00
R6736:Piwil4 UTSW 9 14715823 missense probably benign
R7096:Piwil4 UTSW 9 14736816 nonsense probably null
R7124:Piwil4 UTSW 9 14736900 missense probably benign
R7358:Piwil4 UTSW 9 14729993 missense possibly damaging 0.82
R7371:Piwil4 UTSW 9 14727433 missense probably benign 0.08
R7419:Piwil4 UTSW 9 14702395 missense probably damaging 1.00
R7467:Piwil4 UTSW 9 14705041 missense probably damaging 1.00
R7571:Piwil4 UTSW 9 14734597 missense probably benign 0.08
X0026:Piwil4 UTSW 9 14740591 utr 5 prime probably benign
X0064:Piwil4 UTSW 9 14708875 missense probably benign 0.00
Z1088:Piwil4 UTSW 9 14734517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATTGTACACTCACATTTTGGGG -3'
(R):5'- ACCCTCCATCTAGGCTTTGG -3'

Sequencing Primer
(F):5'- GTACACTCACATTTTGGGGTAGCC -3'
(R):5'- GAGGCCACTTGACTGCCAAC -3'
Posted On2015-06-10