Incidental Mutation 'R4191:Rmnd1'
List |< first << previous [record 39 of 51] next >> last >|
ID318322
Institutional Source Beutler Lab
Gene Symbol Rmnd1
Ensembl Gene ENSMUSG00000019763
Gene Namerequired for meiotic nuclear division 1 homolog
Synonyms
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R4191 (G1)
Quality Score186
Status Validated
Chromosome10
Chromosomal Location4401915-4432388 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 4410809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042251] [ENSMUST00000128434]
Predicted Effect probably benign
Transcript: ENSMUST00000042251
SMART Domains Protein: ENSMUSP00000043355
Gene: ENSMUSG00000019763

DomainStartEndE-ValueType
Pfam:DUF155 227 404 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128434
SMART Domains Protein: ENSMUSP00000119195
Gene: ENSMUSG00000019763

DomainStartEndE-ValueType
Pfam:DUF155 1 42 8.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140660
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved sif2 family of proteins that share the DUF155 domain in common. This protein is thought to be localized in the mitochondria and involved in mitochondrial translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-11. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Rmnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Rmnd1 APN 10 4427392 missense probably benign
IGL01018:Rmnd1 APN 10 4427290 missense probably benign 0.43
IGL01112:Rmnd1 APN 10 4410793 unclassified probably null
R0418:Rmnd1 UTSW 10 4427693 critical splice acceptor site probably null
R2036:Rmnd1 UTSW 10 4407884 missense probably damaging 1.00
R2312:Rmnd1 UTSW 10 4427466 missense probably benign
R2319:Rmnd1 UTSW 10 4422099 missense possibly damaging 0.62
R5077:Rmnd1 UTSW 10 4427488 missense possibly damaging 0.66
R5620:Rmnd1 UTSW 10 4422159 missense probably damaging 1.00
R5659:Rmnd1 UTSW 10 4427382 missense probably benign 0.04
R6291:Rmnd1 UTSW 10 4422135 missense probably damaging 1.00
R7089:Rmnd1 UTSW 10 4403873 missense probably damaging 1.00
R7214:Rmnd1 UTSW 10 4410753 missense probably benign
R7260:Rmnd1 UTSW 10 4414803 intron probably null
R7540:Rmnd1 UTSW 10 4403989 missense probably damaging 1.00
R7599:Rmnd1 UTSW 10 4413404 missense probably benign 0.11
R7719:Rmnd1 UTSW 10 4427496 missense probably benign
R7777:Rmnd1 UTSW 10 4411713 missense probably damaging 1.00
R7809:Rmnd1 UTSW 10 4407848 missense probably damaging 1.00
X0026:Rmnd1 UTSW 10 4427676 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTCCTAACAGAGCCTGG -3'
(R):5'- CCACTTTACAGGTAAGATAAGGAGC -3'

Sequencing Primer
(F):5'- AGCCTGGCTGCTCCTCATG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2015-06-10