Incidental Mutation 'R4191:Myh2'
ID318324
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67177400 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 285 (S285G)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018641
AA Change: S285G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: S285G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124337
Predicted Effect possibly damaging
Transcript: ENSMUST00000170159
AA Change: S285G

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: S285G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATCTGCTGACATCGAGACCTG -3'
(R):5'- TTTCCCACAATTACTCCTGAAAAGC -3'

Sequencing Primer
(F):5'- ACATCGAGACCTGTGAGTGTTC -3'
(R):5'- CTTTGGAGAGGAGTTACGG -3'
Posted On2015-06-10