Incidental Mutation 'R4191:H2-Eb2'
List |< first << previous [record 14 of 51] next >> last >|
ID318333
Institutional Source Beutler Lab
Gene Symbol H2-Eb2
Ensembl Gene ENSMUSG00000067341
Gene Namehistocompatibility 2, class II antigen E beta2
SynonymsA130038H09Rik, Ia5, H-2Eb2, Ia-5
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34325665-34340229 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 34344555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050325]
Predicted Effect probably benign
Transcript: ENSMUST00000050325
SMART Domains Protein: ENSMUSP00000056814
Gene: ENSMUSG00000067341

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
MHC_II_beta 42 115 8.29e-35 SMART
IGc1 140 211 1.24e-26 SMART
transmembrane domain 227 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134042
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in H2-Eb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:H2-Eb2 APN 17 34334367 missense probably damaging 0.98
IGL00965:H2-Eb2 APN 17 34325797 splice site probably null
IGL01380:H2-Eb2 APN 17 34335809 missense probably benign 0.41
IGL02057:H2-Eb2 APN 17 34335767 splice site probably benign
IGL02190:H2-Eb2 APN 17 34334374 missense probably damaging 1.00
IGL02220:H2-Eb2 APN 17 34325687 utr 5 prime probably benign
R0469:H2-Eb2 UTSW 17 34334244 nonsense probably null
R0510:H2-Eb2 UTSW 17 34334244 nonsense probably null
R1169:H2-Eb2 UTSW 17 34333357 missense possibly damaging 0.89
R1334:H2-Eb2 UTSW 17 34334350 missense probably damaging 0.99
R1598:H2-Eb2 UTSW 17 34334374 missense probably damaging 1.00
R1991:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R2103:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R4194:H2-Eb2 UTSW 17 34333326 missense probably benign
R4461:H2-Eb2 UTSW 17 34333523 missense possibly damaging 0.80
R4774:H2-Eb2 UTSW 17 34334401 missense probably damaging 0.99
R4882:H2-Eb2 UTSW 17 34334256 missense probably benign
R5663:H2-Eb2 UTSW 17 34333408 missense possibly damaging 0.92
R6913:H2-Eb2 UTSW 17 34333549 missense possibly damaging 0.89
R7139:H2-Eb2 UTSW 17 34334421 missense probably benign 0.30
R7457:H2-Eb2 UTSW 17 34334347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCTATTTACAGCTGCGTTCC -3'
(R):5'- ATCCCGATTGTCCCAGTCAC -3'

Sequencing Primer
(F):5'- AGCTGCGTTCCCACATCTGG -3'
(R):5'- GATTGTCCCAGTCACCGTCC -3'
Posted On2015-06-10