Mutagenetix > Incidental Mutation

Incidental Mutation 'R4191:Gldc'

318338

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

041022-MU

Accession Numbers

Genbank: NM_138595.1

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4191 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30145658 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 279 (E279G)

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

AlphaFold

Q91W43

Predicted Effect

probably damaging
Transcript: ENSMUST00000025778
AA Change: E279G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: E279G

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Meta Mutation Damage Score

0.3399

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	C	T	17: 47,436,637	R61H	probably damaging	Het
Abcc1	A	G	16: 14,389,864	T22A	probably damaging	Het
Ache	A	T	5: 137,291,072	I347F	probably damaging	Het
Adgrl1	C	G	8: 83,938,940	R1464G	probably benign	Het
Cdh11	T	C	8: 102,650,748	D422G	probably damaging	Het
Cdx1	C	T	18: 61,020,438	S176N	possibly damaging	Het
Csmd3	T	C	15: 47,847,271	D1536G	probably damaging	Het
Cyct	G	T	2: 76,354,191	P72Q	probably damaging	Het
Ddx19b	A	T	8: 111,011,348	L256Q	probably damaging	Het
Disp1	G	T	1: 183,089,173	A561E	probably damaging	Het
Donson	C	A	16: 91,688,592	A41S	possibly damaging	Het
Gpr160	A	T	3: 30,896,714	I312F	possibly damaging	Het
H2-Eb2	G	A	17: 34,344,555		probably benign	Het
Igdcc4	A	G	9: 65,124,151	Q457R	probably benign	Het
Irf2bp2	T	C	8: 126,593,345	D31G	probably damaging	Het
Klrb1	T	A	6: 128,713,634	K42*	probably null	Het
Lrrfip1	A	T	1: 91,110,399	E446D	probably benign	Het
Macf1	A	G	4: 123,473,042	F1077S	possibly damaging	Het
Maml3	A	G	3: 51,689,969	V1098A	probably benign	Het
Mrgpra4	T	C	7: 47,981,119	S245G	probably benign	Het
Mybbp1a	A	G	11: 72,451,287	E1283G	probably damaging	Het
Myh2	A	G	11: 67,177,400	S285G	possibly damaging	Het
Myh7b	A	G	2: 155,633,399	D1876G	probably benign	Het
Nr4a2	T	C	2: 57,112,379	S21G	probably damaging	Het
Olfr1049	C	A	2: 86,255,322	V124L	probably benign	Het
Olfr1384	T	A	11: 49,513,812	M58K	probably damaging	Het
Olfr251	T	A	9: 38,378,352	M157K	probably damaging	Het
Olfr843	A	G	9: 19,249,087	V104A	probably benign	Het
Olfr934	T	A	9: 38,983,017	Q9L	probably benign	Het
Pcdhgb8	G	C	18: 37,763,541	D555H	probably damaging	Het
Pcsk6	T	C	7: 66,025,308	S476P	probably damaging	Het
Pex10	T	C	4: 155,067,905		probably null	Het
Pgf	T	C	12: 85,171,787	D63G	probably benign	Het
Piwil4	A	G	9: 14,715,000	S465P	probably damaging	Het
Plcb1	A	C	2: 135,345,090	H759P	probably damaging	Het
Pmfbp1	A	T	8: 109,527,628	M432L	probably benign	Het
Prodh	C	T	16: 18,073,640	V480I	probably benign	Het
Rmnd1	A	T	10: 4,410,809		probably benign	Het
Senp2	G	T	16: 22,046,667	W580L	probably damaging	Het
Svep1	C	T	4: 58,046,601	C3510Y	possibly damaging	Het
Tanc1	A	G	2: 59,839,013	I1274V	probably damaging	Het
Tep1	T	C	14: 50,836,806	E1874G	probably damaging	Het
Tgfbr2	T	C	9: 116,109,941	T298A	probably damaging	Het
Tlk1	G	A	2: 70,725,547	R423C	probably damaging	Het
Trove2	T	C	1: 143,770,786	I74V	probably benign	Het
Trp53rkb	T	C	2: 166,795,475	I117T	probably damaging	Het
Ttll9	A	G	2: 153,003,007	T432A	probably benign	Het
Vit	A	G	17: 78,586,826	H219R	probably benign	Het
Zfp112	A	G	7: 24,126,143	D512G	probably benign	Het
Zfyve19	A	G	2: 119,210,831	K76R	possibly damaging	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0269:Gldc	UTSW	19	30118602	missense	probably damaging	0.98
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1500:Gldc	UTSW	19	30113825	missense	possibly damaging	0.88
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1592:Gldc	UTSW	19	30160677	intron	probably benign
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3836:Gldc	UTSW	19	30118675	splice site	probably benign
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4655:Gldc	UTSW	19	30160702	intron	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8818:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
R9070:Gldc	UTSW	19	30103004	missense	probably damaging	1.00
R9100:Gldc	UTSW	19	30099914	missense	possibly damaging	0.81
R9144:Gldc	UTSW	19	30137193	missense
R9163:Gldc	UTSW	19	30134286	missense	probably benign	0.13
R9429:Gldc	UTSW	19	30113772	missense	possibly damaging	0.88
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- ACCAGGGATCAGTGAGTGAC -3'
(R):5'- ATGAACATGTCACACGTGCG -3'

Sequencing Primer
(F):5'- CCAGGGATCAGTGAGTGACAGTAAC -3'
(R):5'- GACACACACAGACACACGGG -3'

Posted On

2015-06-10