Incidental Mutation 'R4192:Cfh'
ID 318340
Institutional Source Beutler Lab
Gene Symbol Cfh
Ensembl Gene ENSMUSG00000026365
Gene Name complement component factor h
Synonyms Sas-1, Mud-1, Sas1
MMRRC Submission 041023-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R4192 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 140013593-140111149 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 140030454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 860 (R860H)
Ref Sequence ENSEMBL: ENSMUSP00000066677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880]
AlphaFold P06909
PDB Structure Structure of domains 6 and 7 of the mouse complement regulator Factor H [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066859
AA Change: R860H

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365
AA Change: R860H

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
CCP 1114 1168 8.04e-15 SMART
CCP 1172 1233 5.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111976
AA Change: R878H

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365
AA Change: R878H

DomainStartEndE-ValueType
CCP 39 98 7.75e-8 SMART
CCP 103 159 2.17e-11 SMART
CCP 164 223 7.5e-15 SMART
CCP 228 280 6.29e-8 SMART
CCP 285 338 2.04e-7 SMART
CCP 343 403 6.35e-4 SMART
CCP 407 460 1.15e-10 SMART
CCP 466 523 3.62e-8 SMART
CCP 527 582 6.45e-5 SMART
CCP 587 640 5.56e-9 SMART
CCP 647 701 3.45e-14 SMART
CCP 708 761 1.82e-13 SMART
CCP 770 820 6.59e-1 SMART
CCP 826 879 1.04e-8 SMART
CCP 885 949 4.66e-11 SMART
CCP 954 1007 3.9e-13 SMART
CCP 1012 1066 1.4e-14 SMART
CCP 1071 1125 2.09e-13 SMART
CCP 1132 1186 8.04e-15 SMART
CCP 1190 1251 5.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111977
AA Change: R821H

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365
AA Change: R821H

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 572 626 3.45e-14 SMART
CCP 633 686 1.82e-13 SMART
CCP 695 745 6.59e-1 SMART
CCP 751 804 1.04e-8 SMART
CCP 810 874 4.66e-11 SMART
CCP 879 932 3.9e-13 SMART
CCP 937 991 1.4e-14 SMART
CCP 996 1050 2.09e-13 SMART
CCP 1057 1111 8.04e-15 SMART
CCP 1115 1176 5.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123238
AA Change: R860H

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365
AA Change: R860H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192880
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192919
AA Change: R591H
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 35,818,536 (GRCm39) R178L possibly damaging Het
Acot4 T C 12: 84,089,948 (GRCm39) probably benign Het
Add3 C A 19: 53,230,955 (GRCm39) D543E probably benign Het
Angpt4 A C 2: 151,785,238 (GRCm39) D418A probably benign Het
Ano8 A T 8: 71,935,936 (GRCm39) V260D probably damaging Het
Csmd3 T C 15: 47,710,667 (GRCm39) D1536G probably damaging Het
Dnajb9 A T 12: 44,253,860 (GRCm39) D182E probably benign Het
Epb42 G T 2: 120,860,570 (GRCm39) probably null Het
Fam185a T A 5: 21,630,122 (GRCm39) probably benign Het
Fer1l6 A G 15: 58,518,998 (GRCm39) D1710G probably damaging Het
Gabra2 G A 5: 71,165,341 (GRCm39) P210S probably benign Het
Gm8369 C T 19: 11,479,596 (GRCm39) P9S probably damaging Het
Il17ra A G 6: 120,458,472 (GRCm39) D541G probably damaging Het
Ints4 T G 7: 97,156,940 (GRCm39) H337Q probably damaging Het
Itgam A G 7: 127,663,904 (GRCm39) T44A probably benign Het
Lyst C A 13: 13,915,098 (GRCm39) T3264N probably damaging Het
Macf1 A G 4: 123,366,835 (GRCm39) F1077S possibly damaging Het
Myo3a T A 2: 22,412,188 (GRCm39) F728I probably damaging Het
Nacad T C 11: 6,555,534 (GRCm39) E72G probably benign Het
Nkain3 G A 4: 20,485,003 (GRCm39) Q25* probably null Het
Oca2 T C 7: 55,946,997 (GRCm39) F342S probably damaging Het
Or10d1c T A 9: 38,894,313 (GRCm39) Q9L probably benign Het
Osbpl6 T A 2: 76,415,573 (GRCm39) L499Q probably damaging Het
Pcdhgb8 G C 18: 37,896,594 (GRCm39) D555H probably damaging Het
Peak1 A T 9: 56,166,025 (GRCm39) N634K probably damaging Het
Pitpnm3 T C 11: 71,942,785 (GRCm39) K818R possibly damaging Het
Rab3gap1 T A 1: 127,853,207 (GRCm39) probably benign Het
Rcc1l T C 5: 134,184,648 (GRCm39) T385A probably benign Het
Rrm2 T C 12: 24,758,377 (GRCm39) I11T probably benign Het
Scnn1b A G 7: 121,501,962 (GRCm39) T207A possibly damaging Het
Spata31f3 A T 4: 42,874,185 (GRCm39) probably benign Het
Syt12 T A 19: 4,497,709 (GRCm39) probably benign Het
Tmprss6 A T 15: 78,330,857 (GRCm39) probably null Het
Ttbk1 A T 17: 46,790,173 (GRCm39) C91S probably damaging Het
Ube2q2l T C 6: 136,378,435 (GRCm39) T132A probably benign Het
Vit A G 17: 78,894,255 (GRCm39) H219R probably benign Het
Vmn1r27 A C 6: 58,192,812 (GRCm39) I14R probably damaging Het
Other mutations in Cfh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cfh APN 1 140,016,420 (GRCm39) missense probably damaging 1.00
IGL01124:Cfh APN 1 140,110,999 (GRCm39) missense probably benign 0.01
IGL01389:Cfh APN 1 140,082,377 (GRCm39) missense probably benign 0.44
IGL01455:Cfh APN 1 140,033,277 (GRCm39) missense possibly damaging 0.51
IGL01877:Cfh APN 1 140,028,567 (GRCm39) missense probably damaging 1.00
IGL02836:Cfh APN 1 140,030,137 (GRCm39) missense probably damaging 1.00
IGL02937:Cfh APN 1 140,033,180 (GRCm39) missense probably benign 0.19
IGL03039:Cfh APN 1 140,063,999 (GRCm39) missense possibly damaging 0.86
IGL03069:Cfh APN 1 140,026,793 (GRCm39) intron probably benign
IGL03192:Cfh APN 1 140,026,759 (GRCm39) missense possibly damaging 0.71
IGL03201:Cfh APN 1 140,030,557 (GRCm39) missense probably damaging 1.00
3-1:Cfh UTSW 1 140,090,863 (GRCm39) missense probably damaging 1.00
PIT4449001:Cfh UTSW 1 140,040,303 (GRCm39) missense probably damaging 1.00
R0257:Cfh UTSW 1 140,071,773 (GRCm39) missense probably benign 0.01
R0294:Cfh UTSW 1 140,110,999 (GRCm39) missense probably benign 0.01
R0571:Cfh UTSW 1 140,030,071 (GRCm39) splice site probably null
R0576:Cfh UTSW 1 140,064,553 (GRCm39) missense probably damaging 0.99
R0586:Cfh UTSW 1 140,110,920 (GRCm39) missense probably damaging 0.98
R0605:Cfh UTSW 1 140,030,096 (GRCm39) missense probably damaging 1.00
R0617:Cfh UTSW 1 140,028,621 (GRCm39) missense probably benign 0.01
R0725:Cfh UTSW 1 140,085,081 (GRCm39) splice site probably benign
R0853:Cfh UTSW 1 140,033,228 (GRCm39) missense probably damaging 1.00
R1430:Cfh UTSW 1 140,030,436 (GRCm39) splice site probably benign
R1500:Cfh UTSW 1 140,028,614 (GRCm39) missense probably damaging 1.00
R1533:Cfh UTSW 1 140,028,716 (GRCm39) missense possibly damaging 0.86
R1667:Cfh UTSW 1 140,033,261 (GRCm39) missense probably benign 0.01
R1695:Cfh UTSW 1 140,030,575 (GRCm39) missense probably damaging 0.98
R1728:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1729:Cfh UTSW 1 140,064,526 (GRCm39) missense probably benign 0.02
R1729:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1730:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1739:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1739:Cfh UTSW 1 140,064,526 (GRCm39) missense probably benign 0.02
R1756:Cfh UTSW 1 140,028,615 (GRCm39) missense probably damaging 1.00
R1762:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1762:Cfh UTSW 1 140,064,526 (GRCm39) missense probably benign 0.02
R1783:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1784:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1785:Cfh UTSW 1 140,075,435 (GRCm39) missense possibly damaging 0.55
R1785:Cfh UTSW 1 140,064,526 (GRCm39) missense probably benign 0.02
R1912:Cfh UTSW 1 140,063,879 (GRCm39) splice site probably null
R2273:Cfh UTSW 1 140,030,563 (GRCm39) missense probably damaging 1.00
R2288:Cfh UTSW 1 140,026,639 (GRCm39) missense possibly damaging 0.70
R3725:Cfh UTSW 1 140,014,234 (GRCm39) missense probably damaging 0.99
R3731:Cfh UTSW 1 140,047,708 (GRCm39) missense possibly damaging 0.71
R4060:Cfh UTSW 1 140,047,664 (GRCm39) missense possibly damaging 0.91
R4226:Cfh UTSW 1 140,036,664 (GRCm39) missense probably damaging 1.00
R4425:Cfh UTSW 1 140,028,613 (GRCm39) nonsense probably null
R4431:Cfh UTSW 1 140,064,004 (GRCm39) missense probably damaging 1.00
R4712:Cfh UTSW 1 140,036,274 (GRCm39) missense probably damaging 1.00
R4755:Cfh UTSW 1 140,016,546 (GRCm39) missense probably damaging 1.00
R4792:Cfh UTSW 1 140,028,561 (GRCm39) nonsense probably null
R4831:Cfh UTSW 1 140,014,125 (GRCm39) missense probably benign
R5052:Cfh UTSW 1 140,071,782 (GRCm39) missense probably damaging 0.96
R5181:Cfh UTSW 1 140,075,384 (GRCm39) splice site probably benign
R5205:Cfh UTSW 1 140,071,708 (GRCm39) missense probably damaging 1.00
R5285:Cfh UTSW 1 140,028,636 (GRCm39) missense probably benign 0.21
R5366:Cfh UTSW 1 140,063,973 (GRCm39) missense probably damaging 1.00
R5776:Cfh UTSW 1 140,071,761 (GRCm39) missense possibly damaging 0.83
R5914:Cfh UTSW 1 140,063,967 (GRCm39) missense probably benign 0.39
R5948:Cfh UTSW 1 140,036,546 (GRCm39) missense probably damaging 0.96
R5979:Cfh UTSW 1 140,046,409 (GRCm39) missense possibly damaging 0.66
R6034:Cfh UTSW 1 140,090,869 (GRCm39) missense probably damaging 0.98
R6034:Cfh UTSW 1 140,090,869 (GRCm39) missense probably damaging 0.98
R6059:Cfh UTSW 1 140,046,428 (GRCm39) missense possibly damaging 0.92
R6198:Cfh UTSW 1 140,033,178 (GRCm39) missense probably damaging 1.00
R6306:Cfh UTSW 1 140,030,155 (GRCm39) missense probably damaging 1.00
R6523:Cfh UTSW 1 140,029,445 (GRCm39) missense possibly damaging 0.82
R6610:Cfh UTSW 1 140,029,486 (GRCm39) nonsense probably null
R6652:Cfh UTSW 1 140,071,806 (GRCm39) missense probably benign 0.39
R6852:Cfh UTSW 1 140,075,487 (GRCm39) missense probably damaging 1.00
R6861:Cfh UTSW 1 140,028,621 (GRCm39) missense probably benign 0.07
R6862:Cfh UTSW 1 140,030,100 (GRCm39) missense probably damaging 1.00
R7065:Cfh UTSW 1 140,014,140 (GRCm39) missense probably damaging 0.99
R7191:Cfh UTSW 1 140,040,305 (GRCm39) missense probably benign 0.04
R7197:Cfh UTSW 1 140,016,505 (GRCm39) nonsense probably null
R7355:Cfh UTSW 1 140,064,553 (GRCm39) missense probably damaging 1.00
R7367:Cfh UTSW 1 140,014,259 (GRCm39) missense probably damaging 0.97
R7419:Cfh UTSW 1 140,033,204 (GRCm39) missense probably damaging 0.99
R7579:Cfh UTSW 1 140,036,328 (GRCm39) missense possibly damaging 0.53
R7586:Cfh UTSW 1 140,075,459 (GRCm39) missense probably damaging 0.99
R7985:Cfh UTSW 1 140,036,564 (GRCm39) missense probably damaging 1.00
R8119:Cfh UTSW 1 140,047,753 (GRCm39) missense possibly damaging 0.95
R8277:Cfh UTSW 1 140,029,347 (GRCm39) missense probably damaging 1.00
R8742:Cfh UTSW 1 140,029,390 (GRCm39) missense probably damaging 0.98
R8742:Cfh UTSW 1 140,064,469 (GRCm39) missense probably damaging 0.97
R8743:Cfh UTSW 1 140,046,323 (GRCm39) critical splice donor site probably null
R8874:Cfh UTSW 1 140,014,159 (GRCm39) missense probably damaging 1.00
R8909:Cfh UTSW 1 140,014,086 (GRCm39) missense possibly damaging 0.47
R8949:Cfh UTSW 1 140,026,705 (GRCm39) missense probably damaging 0.98
R9126:Cfh UTSW 1 140,014,111 (GRCm39) missense probably damaging 0.98
R9309:Cfh UTSW 1 140,082,249 (GRCm39) missense probably damaging 0.99
R9441:Cfh UTSW 1 140,030,149 (GRCm39) missense probably benign 0.08
R9502:Cfh UTSW 1 140,040,320 (GRCm39) missense possibly damaging 0.85
R9544:Cfh UTSW 1 140,036,266 (GRCm39) missense probably benign 0.14
R9559:Cfh UTSW 1 140,030,275 (GRCm39) missense probably benign 0.32
R9616:Cfh UTSW 1 140,030,254 (GRCm39) missense probably damaging 0.99
R9617:Cfh UTSW 1 140,090,718 (GRCm39) missense possibly damaging 0.53
R9733:Cfh UTSW 1 140,016,533 (GRCm39) missense probably damaging 1.00
R9748:Cfh UTSW 1 140,090,687 (GRCm39) critical splice donor site probably null
R9788:Cfh UTSW 1 140,036,499 (GRCm39) missense probably benign 0.01
T0975:Cfh UTSW 1 140,082,336 (GRCm39) missense probably benign 0.05
Z1088:Cfh UTSW 1 140,075,456 (GRCm39) missense possibly damaging 0.77
Z1088:Cfh UTSW 1 140,036,642 (GRCm39) missense probably benign 0.04
Z1177:Cfh UTSW 1 140,071,797 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGACTCAATGGAATCTCTCC -3'
(R):5'- TCTATGAAAAGGCAAAACATCCTGC -3'

Sequencing Primer
(F):5'- AATGGAATCTCTCCTTTCTTCTGAAG -3'
(R):5'- GCAAAACATCCTGCCCTCCTC -3'
Posted On 2015-06-10