Incidental Mutation 'R4192:Osbpl6'
ID318342
Institutional Source Beutler Lab
Gene Symbol Osbpl6
Ensembl Gene ENSMUSG00000042359
Gene Nameoxysterol binding protein-like 6
Synonyms1110062M20Rik, ORP-6
MMRRC Submission 041023-MU
Accession Numbers

Genbank: NM_145525; MGI: 2139014

Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76406508-76600647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76585229 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 499 (L499Q)
Ref Sequence ENSEMBL: ENSMUSP00000139363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077972] [ENSMUST00000111929] [ENSMUST00000111930] [ENSMUST00000184442]
Predicted Effect probably damaging
Transcript: ENSMUST00000077972
AA Change: L645Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077123
Gene: ENSMUSG00000042359
AA Change: L645Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
low complexity region 537 550 N/A INTRINSIC
Pfam:Oxysterol_BP 603 951 1.4e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111929
AA Change: L637Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107560
Gene: ENSMUSG00000042359
AA Change: L637Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 441 472 N/A INTRINSIC
low complexity region 529 542 N/A INTRINSIC
Pfam:Oxysterol_BP 595 944 1.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111930
AA Change: L606Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107561
Gene: ENSMUSG00000042359
AA Change: L606Q

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 410 441 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:Oxysterol_BP 564 913 1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184442
AA Change: L499Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139363
Gene: ENSMUSG00000042359
AA Change: L499Q

DomainStartEndE-ValueType
Blast:PH 1 70 8e-41 BLAST
low complexity region 87 98 N/A INTRINSIC
coiled coil region 142 172 N/A INTRINSIC
coiled coil region 303 334 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
Pfam:Oxysterol_BP 457 794 2.6e-135 PFAM
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

 

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Osbpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Osbpl6 APN 2 76590439 missense probably damaging 1.00
IGL01109:Osbpl6 APN 2 76549527 missense probably damaging 1.00
IGL01288:Osbpl6 APN 2 76564823 missense probably damaging 0.98
IGL01717:Osbpl6 APN 2 76588594 missense probably damaging 1.00
IGL02146:Osbpl6 APN 2 76549750 missense possibly damaging 0.90
IGL02597:Osbpl6 APN 2 76555974 nonsense probably null
IGL02652:Osbpl6 APN 2 76593454 missense probably damaging 1.00
IGL02867:Osbpl6 APN 2 76595870 splice site probably benign
IGL03143:Osbpl6 APN 2 76548372 missense probably damaging 1.00
3-1:Osbpl6 UTSW 2 76586151 missense probably damaging 1.00
R0085:Osbpl6 UTSW 2 76593414 missense probably benign 0.30
R0201:Osbpl6 UTSW 2 76546042 missense possibly damaging 0.92
R0573:Osbpl6 UTSW 2 76590391 missense probably damaging 1.00
R0644:Osbpl6 UTSW 2 76594840 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76585133 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76591839 missense probably damaging 1.00
R1017:Osbpl6 UTSW 2 76549719 missense probably damaging 1.00
R1459:Osbpl6 UTSW 2 76555065 missense probably benign 0.01
R1505:Osbpl6 UTSW 2 76579242 missense probably damaging 1.00
R1588:Osbpl6 UTSW 2 76579216 missense probably benign
R1786:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R1863:Osbpl6 UTSW 2 76585058 missense probably damaging 1.00
R2131:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2132:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2133:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2233:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2235:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2256:Osbpl6 UTSW 2 76584474 missense probably damaging 1.00
R2294:Osbpl6 UTSW 2 76577079 missense possibly damaging 0.81
R3023:Osbpl6 UTSW 2 76586733 missense probably damaging 1.00
R4544:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4546:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4664:Osbpl6 UTSW 2 76568208 missense probably benign 0.02
R4764:Osbpl6 UTSW 2 76546000 missense probably damaging 1.00
R4884:Osbpl6 UTSW 2 76549539 missense probably damaging 1.00
R5080:Osbpl6 UTSW 2 76524085 missense probably benign 0.31
R5430:Osbpl6 UTSW 2 76586138 missense probably damaging 1.00
R5614:Osbpl6 UTSW 2 76568109 missense probably damaging 1.00
R5807:Osbpl6 UTSW 2 76584513 missense probably damaging 0.98
R5956:Osbpl6 UTSW 2 76549512 missense probably damaging 1.00
R6394:Osbpl6 UTSW 2 76555954 missense probably benign 0.00
R6430:Osbpl6 UTSW 2 76579276 missense probably damaging 1.00
R6450:Osbpl6 UTSW 2 76564830 missense possibly damaging 0.90
R7116:Osbpl6 UTSW 2 76595881 missense probably benign 0.06
R7385:Osbpl6 UTSW 2 76549450 missense probably damaging 1.00
R7422:Osbpl6 UTSW 2 76593386 missense probably damaging 1.00
R7561:Osbpl6 UTSW 2 76586154 missense probably damaging 1.00
R7829:Osbpl6 UTSW 2 76593387 missense probably damaging 1.00
R7921:Osbpl6 UTSW 2 76585097 missense probably damaging 1.00
R8183:Osbpl6 UTSW 2 76585060 missense probably damaging 1.00
R8219:Osbpl6 UTSW 2 76555903 missense probably damaging 0.98
R8548:Osbpl6 UTSW 2 76579222 missense possibly damaging 0.88
R8682:Osbpl6 UTSW 2 76577081 missense probably benign 0.00
Z1177:Osbpl6 UTSW 2 76540179 missense probably benign 0.01
Z31818:Osbpl6 UTSW 2 76555082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTATGAAGCCAGAGCGGG -3'
(R):5'- GAACAGGCCATGGAAACCTC -3'

Sequencing Primer
(F):5'- GGGAAGCATCACTCTCTCTG -3'
(R):5'- CGTGAGTAGCTTCCAATAAGAGTATC -3'
Posted On2015-06-10