Incidental Mutation 'R4192:Epb42'
ID318343
Institutional Source Beutler Lab
Gene Symbol Epb42
Ensembl Gene ENSMUSG00000023216
Gene Nameerythrocyte membrane protein band 4.2
SynonymsEpb4.2
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121017891-121037072 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 121030089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023987] [ENSMUST00000102490]
Predicted Effect probably null
Transcript: ENSMUST00000023987
SMART Domains Protein: ENSMUSP00000023987
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 5 126 8.9e-35 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 552 5.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102490
SMART Domains Protein: ENSMUSP00000099548
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 6 124 5.8e-34 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 580 8e-23 PFAM
Pfam:Transglut_C 588 686 8.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152217
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: The protein encoded by this gene is the key component of a macromolecular complex involved in the structure of erythrocytes. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit erythrocytic abnormalities including mild spherocytosis, altered ion transport, and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Epb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Epb42 APN 2 121027688 missense probably damaging 1.00
IGL01627:Epb42 APN 2 121025843 missense probably benign 0.06
IGL02059:Epb42 APN 2 121024707 missense probably damaging 0.96
IGL02869:Epb42 APN 2 121025746 missense probably benign
R0279:Epb42 UTSW 2 121029044 splice site probably benign
R0521:Epb42 UTSW 2 121029150 nonsense probably null
R1457:Epb42 UTSW 2 121029967 critical splice donor site probably null
R2157:Epb42 UTSW 2 121021762 missense probably benign
R2392:Epb42 UTSW 2 121029987 missense possibly damaging 0.85
R2407:Epb42 UTSW 2 121024752 missense probably damaging 1.00
R2866:Epb42 UTSW 2 121025921 missense possibly damaging 0.93
R2993:Epb42 UTSW 2 121029044 splice site probably benign
R3426:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R3427:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R4940:Epb42 UTSW 2 121034451 missense probably damaging 1.00
R5368:Epb42 UTSW 2 121019462 missense probably benign 0.22
R5771:Epb42 UTSW 2 121021820 missense probably damaging 0.99
R6048:Epb42 UTSW 2 121024408 missense probably benign 0.00
R6362:Epb42 UTSW 2 121025779 missense possibly damaging 0.72
R6475:Epb42 UTSW 2 121027133 missense possibly damaging 0.53
R6711:Epb42 UTSW 2 121024108 intron probably benign
R6843:Epb42 UTSW 2 121027685 missense possibly damaging 0.85
R6895:Epb42 UTSW 2 121036623 start gained probably benign
R7154:Epb42 UTSW 2 121033362 missense probably benign 0.01
R7192:Epb42 UTSW 2 121024097 missense unknown
R7600:Epb42 UTSW 2 121021826 missense probably damaging 1.00
R7757:Epb42 UTSW 2 121027719 missense possibly damaging 0.91
R7779:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7781:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7782:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7783:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7784:Epb42 UTSW 2 121034435 missense probably benign 0.14
R8737:Epb42 UTSW 2 121025843 missense possibly damaging 0.75
Z1177:Epb42 UTSW 2 121027725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCTTTGGCCTGAGTATTG -3'
(R):5'- AAAGAGTGGCTTGCTCCTAG -3'

Sequencing Primer
(F):5'- GAAGGTTATGTGTGCCTCTTCTTCC -3'
(R):5'- TTAACAGAGGGTGAGTGGTCC -3'
Posted On2015-06-10