Incidental Mutation 'R4192:Angpt4'
ID318344
Institutional Source Beutler Lab
Gene Symbol Angpt4
Ensembl Gene ENSMUSG00000027460
Gene Nameangiopoietin 4
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location151911210-151945337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 151943318 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 418 (D418A)
Ref Sequence ENSEMBL: ENSMUSP00000028955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028955]
Predicted Effect probably benign
Transcript: ENSMUST00000028955
AA Change: D418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028955
Gene: ENSMUSG00000027460
AA Change: D418A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
coiled coil region 181 239 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
FBG 292 507 2.23e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142642
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene is a member of the angiopoietin family of secreted growth factors comprising Angiopoietins-1, -2, and -3, all of which bind the TEK Receptor Tyrosine Kinase. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is involved in survival and migration of endothelial cells and regulates vascular remodeling and maintenance of vascular integrity. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is also required for lymphangiogenesis. Family members bind TEK Receptor Tyrosine Kinase as multimeric clusters but their oligomerization properties differ from one another and this is thought to provide a mechanistic basis for their distinct physiologic roles. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Angpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Angpt4 APN 2 151911471 missense probably damaging 0.99
IGL03107:Angpt4 APN 2 151943422 missense probably benign 0.08
IGL03343:Angpt4 APN 2 151936703 missense probably damaging 1.00
R0034:Angpt4 UTSW 2 151929391 missense probably benign 0.44
R0709:Angpt4 UTSW 2 151934514 missense possibly damaging 0.46
R0764:Angpt4 UTSW 2 151911284 start gained probably benign
R0853:Angpt4 UTSW 2 151938927 missense probably damaging 1.00
R1796:Angpt4 UTSW 2 151938989 missense probably damaging 1.00
R2091:Angpt4 UTSW 2 151936783 splice site probably benign
R2184:Angpt4 UTSW 2 151938954 missense probably damaging 1.00
R2901:Angpt4 UTSW 2 151911339 missense unknown
R3014:Angpt4 UTSW 2 151929597 missense probably benign 0.07
R4440:Angpt4 UTSW 2 151944646 missense probably damaging 1.00
R5059:Angpt4 UTSW 2 151934440 missense probably damaging 1.00
R5326:Angpt4 UTSW 2 151925544 critical splice donor site probably null
R6345:Angpt4 UTSW 2 151929434 missense probably benign 0.00
R7232:Angpt4 UTSW 2 151929540 missense possibly damaging 0.63
R7313:Angpt4 UTSW 2 151925406 missense probably benign
R7456:Angpt4 UTSW 2 151939067 missense probably damaging 1.00
R7598:Angpt4 UTSW 2 151925525 missense possibly damaging 0.95
R7823:Angpt4 UTSW 2 151911366 missense unknown
Predicted Primers PCR Primer
(F):5'- TAAAAGTCCCAGGAGCGGTG -3'
(R):5'- TCGGATACACTCACCTCCAG -3'

Sequencing Primer
(F):5'- CCCCAGGGTGGCAAATAAG -3'
(R):5'- TCAGAACACATTCACCTCCAGATATC -3'
Posted On2015-06-10