Incidental Mutation 'R4192:Fam185a'
ID318348
Institutional Source Beutler Lab
Gene Symbol Fam185a
Ensembl Gene ENSMUSG00000047221
Gene Namefamily with sequence similarity 185, member A
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4192 (G1)
Quality Score134
Status Validated
Chromosome5
Chromosomal Location21424958-21482124 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 21425124 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030552] [ENSMUST00000056045] [ENSMUST00000115245]
Predicted Effect probably benign
Transcript: ENSMUST00000030552
SMART Domains Protein: ENSMUSP00000030552
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056045
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115245
SMART Domains Protein: ENSMUSP00000110900
Gene: ENSMUSG00000064280

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 120 130 N/A INTRINSIC
coiled coil region 194 320 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
coiled coil region 438 477 N/A INTRINSIC
coiled coil region 549 595 N/A INTRINSIC
coiled coil region 617 663 N/A INTRINSIC
coiled coil region 690 720 N/A INTRINSIC
coiled coil region 770 793 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153301
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Fam185a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Fam185a APN 5 21480342 missense probably damaging 1.00
IGL01980:Fam185a APN 5 21459173 missense probably damaging 1.00
IGL02096:Fam185a APN 5 21425343 missense probably damaging 1.00
IGL02264:Fam185a APN 5 21480394 missense possibly damaging 0.63
IGL02553:Fam185a APN 5 21455831 missense probably damaging 1.00
IGL02553:Fam185a APN 5 21429841 splice site probably benign
IGL03082:Fam185a APN 5 21455838 missense possibly damaging 0.49
famine UTSW 5 21425454 missense probably benign 0.00
R0389:Fam185a UTSW 5 21459285 missense probably damaging 0.99
R1872:Fam185a UTSW 5 21480330 critical splice acceptor site probably null
R1883:Fam185a UTSW 5 21425244 missense possibly damaging 0.85
R3775:Fam185a UTSW 5 21455806 missense probably damaging 1.00
R4190:Fam185a UTSW 5 21425124 unclassified probably benign
R4194:Fam185a UTSW 5 21425454 missense probably benign 0.00
R4704:Fam185a UTSW 5 21480473 utr 3 prime probably benign
R4724:Fam185a UTSW 5 21455787 missense probably damaging 1.00
R4837:Fam185a UTSW 5 21480377 missense probably benign 0.00
R6225:Fam185a UTSW 5 21425556 missense probably damaging 0.99
R6438:Fam185a UTSW 5 21458972 unclassified probably null
R6475:Fam185a UTSW 5 21425283 missense probably benign 0.01
R7512:Fam185a UTSW 5 21447358 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGGTGACTTGTCCAGGTCAG -3'
(R):5'- ATACTTGACCTGCAGGCTG -3'

Sequencing Primer
(F):5'- CCAGGTCAGGGTTTCAACTAG -3'
(R):5'- TTGACCTGCAGGCTGTCCAG -3'
Posted On2015-06-10