Incidental Mutation 'R4192:Gabra2'
ID318349
Institutional Source Beutler Lab
Gene Symbol Gabra2
Ensembl Gene ENSMUSG00000000560
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 2
SynonymsC630048P16Rik, Gabra-2
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location70957597-71095849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71007998 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 210 (P210S)
Ref Sequence ENSEMBL: ENSMUSP00000142892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000572] [ENSMUST00000197284] [ENSMUST00000198625]
Predicted Effect probably benign
Transcript: ENSMUST00000000572
SMART Domains Protein: ENSMUSP00000000572
Gene: ENSMUSG00000000560

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 1.9e-51 PFAM
Pfam:Neur_chan_memb 257 344 1.2e-32 PFAM
low complexity region 364 375 N/A INTRINSIC
low complexity region 392 410 N/A INTRINSIC
transmembrane domain 423 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197124
Predicted Effect probably benign
Transcript: ENSMUST00000197284
AA Change: P210S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142892
Gene: ENSMUSG00000000560
AA Change: P210S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 2.7e-53 PFAM
Pfam:Neur_chan_memb 257 354 5.6e-38 PFAM
Pfam:Neur_chan_memb 343 437 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198625
SMART Domains Protein: ENSMUSP00000143645
Gene: ENSMUSG00000000560

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
SCOP:d1i9ba_ 47 87 7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199861
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knockout allele are resistant to the anxiolytic effects of diazepam (DZP). Mice homozygous for a different knock-out allele exhibit reduced DZP-induced antihyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Gabra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Gabra2 APN 5 70962072 missense probably benign
IGL01084:Gabra2 APN 5 71006233 missense probably damaging 1.00
IGL01948:Gabra2 APN 5 70961885 missense probably damaging 1.00
IGL01965:Gabra2 APN 5 71008075 splice site probably benign
IGL03263:Gabra2 APN 5 70973493 missense probably damaging 1.00
R0005:Gabra2 UTSW 5 70973436 missense probably benign 0.00
R0751:Gabra2 UTSW 5 71092099 splice site probably benign
R1025:Gabra2 UTSW 5 70973595 missense probably damaging 1.00
R1713:Gabra2 UTSW 5 71014563 missense probably benign 0.24
R1964:Gabra2 UTSW 5 71014450 missense possibly damaging 0.91
R3861:Gabra2 UTSW 5 70973543 missense probably damaging 1.00
R4190:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R4193:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R6281:Gabra2 UTSW 5 71034762 missense probably damaging 1.00
R6419:Gabra2 UTSW 5 70962083 missense probably benign 0.00
R6814:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R6872:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R7922:Gabra2 UTSW 5 71007972 nonsense probably null
R8253:Gabra2 UTSW 5 71092070 missense probably benign 0.00
Z1177:Gabra2 UTSW 5 71007992 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTTTCATTAATCTATAGATCCCAAGGG -3'
(R):5'- TTCTCAAAGTGGTACCAATGAAAG -3'

Sequencing Primer
(F):5'- AATGTTACTGACCTGTACTG -3'
(R):5'- AAAGTATTTTCATGCTCATGGTTGGC -3'
Posted On2015-06-10