Incidental Mutation 'R4192:Rcc1l'
ID318350
Institutional Source Beutler Lab
Gene Symbol Rcc1l
Ensembl Gene ENSMUSG00000061979
Gene Namereculator of chromosome condensation 1 like
SynonymsWbscr16, 5730496C04Rik
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134148054-134176774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134155809 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 385 (T385A)
Ref Sequence ENSEMBL: ENSMUSP00000075581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076228]
Predicted Effect probably benign
Transcript: ENSMUST00000076228
AA Change: T385A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075581
Gene: ENSMUSG00000061979
AA Change: T385A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 28 40 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:RCC1 127 186 2.3e-10 PFAM
Pfam:RCC1_2 173 202 1e-9 PFAM
Pfam:RCC1 190 242 5.6e-11 PFAM
Pfam:RCC1_2 229 258 2.9e-12 PFAM
Pfam:RCC1 245 295 5.1e-8 PFAM
Pfam:RCC1 298 348 2e-12 PFAM
Pfam:RCC1_2 391 422 2.6e-9 PFAM
Pfam:RCC1 409 456 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126113
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing regulator of chromosome condensation 1-like repeats. The encoded protein may function as a guanine nucleotide exchange factor. This gene is located in a region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Rcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0563:Rcc1l UTSW 5 134176555 missense probably benign 0.16
R1834:Rcc1l UTSW 5 134163659 missense probably damaging 1.00
R2108:Rcc1l UTSW 5 134155790 missense probably benign 0.00
R2512:Rcc1l UTSW 5 134166669 missense probably damaging 0.98
R3705:Rcc1l UTSW 5 134154191 missense probably damaging 1.00
R4658:Rcc1l UTSW 5 134171890 missense probably damaging 1.00
R4791:Rcc1l UTSW 5 134163776 missense possibly damaging 0.89
R6076:Rcc1l UTSW 5 134169328 missense possibly damaging 0.90
R6291:Rcc1l UTSW 5 134166721 splice site probably null
R6508:Rcc1l UTSW 5 134169238 missense probably damaging 1.00
R6799:Rcc1l UTSW 5 134176713 start codon destroyed probably null
R7344:Rcc1l UTSW 5 134176437 missense probably benign 0.03
R7971:Rcc1l UTSW 5 134165369 missense probably damaging 0.99
Z1177:Rcc1l UTSW 5 134163757 missense probably benign 0.10
Z1177:Rcc1l UTSW 5 134165408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACAAACTGGGCTACCTCTG -3'
(R):5'- ATTTTATGGCAAGGGAGGGC -3'

Sequencing Primer
(F):5'- CCTGTGAAGACATAAGCCTATTGG -3'
(R):5'- CAAGGGAGGGCTCTGCTTG -3'
Posted On2015-06-10