Incidental Mutation 'R4192:Il17ra'
ID318352
Institutional Source Beutler Lab
Gene Symbol Il17ra
Ensembl Gene ENSMUSG00000002897
Gene Nameinterleukin 17 receptor A
SynonymsVDw217, Il17r
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120463247-120487559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120481511 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 541 (D541G)
Ref Sequence ENSEMBL: ENSMUSP00000002976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002976]
Predicted Effect probably damaging
Transcript: ENSMUST00000002976
AA Change: D541G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897
AA Change: D541G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 48 198 1.3e-70 PFAM
Pfam:IL17R_fnIII_D2 199 303 9.6e-53 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:SEFIR 380 539 1.5e-51 PFAM
low complexity region 747 765 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204239
Meta Mutation Damage Score 0.4970 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Il17ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Il17ra APN 6 120481465 missense probably damaging 1.00
IGL01413:Il17ra APN 6 120475581 missense probably benign 0.00
IGL01418:Il17ra APN 6 120475581 missense probably benign 0.00
IGL03215:Il17ra APN 6 120472114 missense probably damaging 1.00
IGL03047:Il17ra UTSW 6 120481226 missense probably damaging 1.00
PIT4305001:Il17ra UTSW 6 120481406 missense probably damaging 1.00
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0365:Il17ra UTSW 6 120478449 missense probably benign 0.03
R0391:Il17ra UTSW 6 120476979 splice site probably benign
R0470:Il17ra UTSW 6 120481806 missense probably benign 0.01
R0599:Il17ra UTSW 6 120481505 missense probably damaging 1.00
R1525:Il17ra UTSW 6 120473790 missense probably damaging 0.98
R1900:Il17ra UTSW 6 120477394 critical splice acceptor site probably null
R1972:Il17ra UTSW 6 120482216 missense probably benign 0.01
R4923:Il17ra UTSW 6 120477445 missense possibly damaging 0.94
R5009:Il17ra UTSW 6 120482207 missense probably benign 0.00
R5133:Il17ra UTSW 6 120481553 missense possibly damaging 0.81
R5411:Il17ra UTSW 6 120481442 missense probably damaging 1.00
R5548:Il17ra UTSW 6 120478473 missense probably benign 0.23
R6137:Il17ra UTSW 6 120475582 missense probably benign 0.23
R6190:Il17ra UTSW 6 120475273 missense probably damaging 1.00
R7202:Il17ra UTSW 6 120475611 missense probably benign 0.01
R7300:Il17ra UTSW 6 120482102 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTTCACTGCAGCCATGAAC -3'
(R):5'- GCAGTGGGTCTTCAAACACTTC -3'

Sequencing Primer
(F):5'- TGCAGCCATGAACATGATCCTG -3'
(R):5'- CTTCTTCATCCAGGGAGGGAAGATC -3'
Posted On2015-06-10