Incidental Mutation 'R4192:E330021D16Rik'
ID318353
Institutional Source Beutler Lab
Gene Symbol E330021D16Rik
Ensembl Gene ENSMUSG00000045291
Gene NameRIKEN cDNA E330021D16 gene
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136400317-136415569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136401437 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 132 (T132A)
Ref Sequence ENSEMBL: ENSMUSP00000145343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058713] [ENSMUST00000203392] [ENSMUST00000204830]
Predicted Effect probably benign
Transcript: ENSMUST00000058713
AA Change: T132A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000060726
Gene: ENSMUSG00000045291
AA Change: T132A

DomainStartEndE-ValueType
Blast:RWD 7 135 7e-63 BLAST
low complexity region 157 168 N/A INTRINSIC
UBCc 204 364 2.33e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203392
SMART Domains Protein: ENSMUSP00000144858
Gene: ENSMUSG00000045291

DomainStartEndE-ValueType
Pfam:RWD 1 110 8.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204830
AA Change: T132A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145343
Gene: ENSMUSG00000045291
AA Change: T132A

DomainStartEndE-ValueType
Blast:RWD 7 135 7e-63 BLAST
low complexity region 157 168 N/A INTRINSIC
UBCc 204 364 2.33e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in E330021D16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:E330021D16Rik APN 6 136400998 missense possibly damaging 0.53
IGL01701:E330021D16Rik APN 6 136400806 missense probably damaging 0.99
IGL02194:E330021D16Rik APN 6 136401058 missense probably benign 0.00
IGL03266:E330021D16Rik APN 6 136400923 missense probably damaging 1.00
R1270:E330021D16Rik UTSW 6 136401787 missense probably damaging 0.97
R1893:E330021D16Rik UTSW 6 136401827 missense possibly damaging 0.92
R5371:E330021D16Rik UTSW 6 136401373 missense probably benign 0.02
R6418:E330021D16Rik UTSW 6 136401101 missense probably damaging 1.00
R6999:E330021D16Rik UTSW 6 136401274 missense probably benign 0.01
R7035:E330021D16Rik UTSW 6 136401349 missense possibly damaging 0.77
R7316:E330021D16Rik UTSW 6 136401278 missense possibly damaging 0.92
R8125:E330021D16Rik UTSW 6 136401186 missense possibly damaging 0.72
R8179:E330021D16Rik UTSW 6 136401242 missense probably damaging 1.00
R8222:E330021D16Rik UTSW 6 136400884 missense probably damaging 0.97
R8225:E330021D16Rik UTSW 6 136401112 missense probably damaging 1.00
R8421:E330021D16Rik UTSW 6 136401352 missense probably damaging 0.97
R8784:E330021D16Rik UTSW 6 136401731 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTATCTGAAGCACACACTGAGC -3'
(R):5'- GGACTCTGACGATCCAGATCTC -3'

Sequencing Primer
(F):5'- AGACGTGGCACCACTTG -3'
(R):5'- GATCCAGATCTCACATCGATCCTGG -3'
Posted On2015-06-10