Mutagenetix > Incidental Mutations

Incidental Mutation 'R4192:Oca2'

318354

Institutional Source

Beutler Lab

Gene Symbol

Oca2

Ensembl Gene

ENSMUSG00000030450

Gene Name

oculocutaneous albinism II

Synonyms

D7H15S12, p, D7H15S12

MMRRC Submission

041023-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.223) question?

Stock #

R4192 (G1)

Quality Score

104

Status

Validated

Chromosome

Chromosomal Location

56239760-56536518 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56297249 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 342 (F342S)

Ref Sequence

ENSEMBL: ENSMUSP00000032633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032633
AA Change: F342S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: F342S

Domain	Start	End	E-Value	Type
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ArsB	319	558	2e-10	PFAM
Pfam:CitMHS	337	770	2e-49	PFAM
Pfam:ArsB	562	827	8.9e-9	PFAM
Pfam:Na_sulph_symp	573	832	6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144739

Predicted Effect

probably benign
Transcript: ENSMUST00000152693

SMART Domains

Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

Domain	Start	End	E-Value	Type
transmembrane domain	171	193	N/A	INTRINSIC

Meta Mutation Damage Score

0.4061

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	G	T	14: 36,096,579	R178L	possibly damaging	Het
Acot4	T	C	12: 84,043,174		probably benign	Het
Add3	C	A	19: 53,242,524	D543E	probably benign	Het
Angpt4	A	C	2: 151,943,318	D418A	probably benign	Het
Ano8	A	T	8: 71,483,292	V260D	probably damaging	Het
Cfh	C	T	1: 140,102,716	R860H	possibly damaging	Het
Csmd3	T	C	15: 47,847,271	D1536G	probably damaging	Het
Dnajb9	A	T	12: 44,207,077	D182E	probably benign	Het
E330021D16Rik	T	C	6: 136,401,437	T132A	probably benign	Het
Epb42	G	T	2: 121,030,089		probably null	Het
Fam185a	T	A	5: 21,425,124		probably benign	Het
Fam205c	A	T	4: 42,874,185		probably benign	Het
Fer1l6	A	G	15: 58,647,149	D1710G	probably damaging	Het
Gabra2	G	A	5: 71,007,998	P210S	probably benign	Het
Gm8369	C	T	19: 11,502,232	P9S	probably damaging	Het
Il17ra	A	G	6: 120,481,511	D541G	probably damaging	Het
Ints4	T	G	7: 97,507,733	H337Q	probably damaging	Het
Itgam	A	G	7: 128,064,732	T44A	probably benign	Het
Lyst	C	A	13: 13,740,513	T3264N	probably damaging	Het
Macf1	A	G	4: 123,473,042	F1077S	possibly damaging	Het
Myo3a	T	A	2: 22,407,377	F728I	probably damaging	Het
Nacad	T	C	11: 6,605,534	E72G	probably benign	Het
Nkain3	G	A	4: 20,485,003	Q25*	probably null	Het
Olfr934	T	A	9: 38,983,017	Q9L	probably benign	Het
Osbpl6	T	A	2: 76,585,229	L499Q	probably damaging	Het
Pcdhgb8	G	C	18: 37,763,541	D555H	probably damaging	Het
Peak1	A	T	9: 56,258,741	N634K	probably damaging	Het
Pitpnm3	T	C	11: 72,051,959	K818R	possibly damaging	Het
Rab3gap1	T	A	1: 127,925,470		probably benign	Het
Rcc1l	T	C	5: 134,155,809	T385A	probably benign	Het
Rrm2	T	C	12: 24,708,378	I11T	probably benign	Het
Scnn1b	A	G	7: 121,902,739	T207A	possibly damaging	Het
Syt12	T	A	19: 4,447,681		probably benign	Het
Tmprss6	A	T	15: 78,446,657		probably null	Het
Ttbk1	A	T	17: 46,479,247	C91S	probably damaging	Het
Vit	A	G	17: 78,586,826	H219R	probably benign	Het
Vmn1r27	A	C	6: 58,215,827	I14R	probably damaging	Het

Other mutations in Oca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Oca2	APN	7	56280846	missense	probably damaging	0.99
IGL01022:Oca2	APN	7	56324756	missense	probably damaging	1.00
IGL01666:Oca2	APN	7	56314811	splice site	probably null
IGL02157:Oca2	APN	7	56324797	splice site	probably null
IGL02213:Oca2	APN	7	56321484	splice site	probably benign
IGL02314:Oca2	APN	7	56357151	missense	probably benign	0.00
IGL03083:Oca2	APN	7	56295484	missense	probably benign	0.28
IGL03356:Oca2	APN	7	56535968	missense	probably benign	0.01
charbon	UTSW	7	56316405	missense	probably damaging	1.00
cotton	UTSW	7	56535968	missense	probably benign	0.00
Dirk	UTSW	7	56535968	missense	probably benign	0.00
draco1	UTSW	7	56423352	missense	probably benign	0.00
faded	UTSW	7	56324661	missense	probably benign	0.19
hardy	UTSW	7	56295460	missense	probably damaging	1.00
narwhal	UTSW	7	56295498	nonsense	probably null
quicksilver	UTSW	7	56324661	missense	probably benign	0.19
renesmee	UTSW	7	56535968	missense	probably benign	0.00
snowflake	UTSW	7	56324680	missense	probably damaging	1.00
whitemouse	UTSW	7	56414431	missense	probably damaging	1.00
R0440:Oca2	UTSW	7	56423352	missense	probably benign	0.00
R1067:Oca2	UTSW	7	56316393	missense	probably damaging	1.00
R1349:Oca2	UTSW	7	56535968	missense	probably benign	0.00
R1372:Oca2	UTSW	7	56535968	missense	probably benign	0.00
R1457:Oca2	UTSW	7	56321521	missense	probably damaging	1.00
R1737:Oca2	UTSW	7	56328785	missense	probably damaging	1.00
R1802:Oca2	UTSW	7	56254980	missense	possibly damaging	0.96
R1957:Oca2	UTSW	7	56321498	missense	possibly damaging	0.82
R1966:Oca2	UTSW	7	56414467	missense	probably damaging	0.99
R2082:Oca2	UTSW	7	56297137	missense	probably benign	0.01
R2229:Oca2	UTSW	7	56357155	missense	probably benign	0.11
R4120:Oca2	UTSW	7	56254882	missense	probably damaging	1.00
R4405:Oca2	UTSW	7	56414434	missense	possibly damaging	0.63
R4654:Oca2	UTSW	7	56328812	missense	probably benign	0.44
R4701:Oca2	UTSW	7	56255002	missense	probably benign	0.00
R4887:Oca2	UTSW	7	56330358	nonsense	probably null
R5053:Oca2	UTSW	7	56323580	missense	probably benign	0.02
R5215:Oca2	UTSW	7	56295498	nonsense	probably null
R5430:Oca2	UTSW	7	56295460	missense	probably damaging	1.00
R5677:Oca2	UTSW	7	56414462	missense	probably damaging	1.00
R6416:Oca2	UTSW	7	56328767	missense	probably benign	0.44
R6645:Oca2	UTSW	7	56314774	missense	probably benign	0.21
R7257:Oca2	UTSW	7	56279538	intron	probably benign
R7409:Oca2	UTSW	7	56414397	missense	probably benign	0.00
R7530:Oca2	UTSW	7	56331972	missense	probably damaging	0.99
R7820:Oca2	UTSW	7	56331965	missense	probably damaging	1.00
Z1088:Oca2	UTSW	7	56330375	missense	probably null	0.83

Predicted Primers

PCR Primer
(F):5'- CTGACCAACCTCAAGGGATTTG -3'
(R):5'- TCACGAAGCTTTTCTGGTCC -3'

Sequencing Primer
(F):5'- CCTCAAGGGATTTGATTTATTTTGC -3'
(R):5'- TTTTTGTCAGTGCCCATGATTCAG -3'

Posted On

2015-06-10