Incidental Mutation 'R4192:Ints4'
ID318355
Institutional Source Beutler Lab
Gene Symbol Ints4
Ensembl Gene ENSMUSG00000025133
Gene Nameintegrator complex subunit 4
Synonyms2610034N24Rik
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97480956-97541395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 97507733 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 337 (H337Q)
Ref Sequence ENSEMBL: ENSMUSP00000026126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026126]
Predicted Effect probably damaging
Transcript: ENSMUST00000026126
AA Change: H337Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133
AA Change: H337Q

DomainStartEndE-ValueType
Pfam:HEAT_2 153 258 9.8e-9 PFAM
Pfam:Cohesin_HEAT 179 219 7.7e-6 PFAM
low complexity region 518 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206644
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Ints4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Ints4 APN 7 97535205 missense probably damaging 1.00
IGL01736:Ints4 APN 7 97526642 missense probably benign 0.01
IGL01862:Ints4 APN 7 97541153 missense probably damaging 1.00
IGL02277:Ints4 APN 7 97487458 missense probably damaging 1.00
IGL02396:Ints4 APN 7 97537900 missense possibly damaging 0.64
IGL02661:Ints4 APN 7 97495705 missense probably benign
IGL02750:Ints4 APN 7 97517757 critical splice donor site probably null
IGL03108:Ints4 APN 7 97490930 critical splice acceptor site probably null
R0332:Ints4 UTSW 7 97517718 missense probably damaging 1.00
R0449:Ints4 UTSW 7 97529223 missense probably damaging 0.97
R1065:Ints4 UTSW 7 97507892 critical splice donor site probably null
R1722:Ints4 UTSW 7 97513579 missense probably benign 0.24
R2060:Ints4 UTSW 7 97501763 missense possibly damaging 0.93
R2211:Ints4 UTSW 7 97509750 missense possibly damaging 0.63
R3731:Ints4 UTSW 7 97506101 missense probably benign 0.18
R3881:Ints4 UTSW 7 97516257 missense possibly damaging 0.94
R4089:Ints4 UTSW 7 97529255 nonsense probably null
R4479:Ints4 UTSW 7 97484971 missense probably damaging 1.00
R4980:Ints4 UTSW 7 97501850 critical splice donor site probably null
R5029:Ints4 UTSW 7 97509774 missense probably benign 0.06
R5306:Ints4 UTSW 7 97509678 missense probably damaging 1.00
R6160:Ints4 UTSW 7 97509583 splice site probably null
R6317:Ints4 UTSW 7 97529218 nonsense probably null
R6961:Ints4 UTSW 7 97541190 makesense probably null
R7026:Ints4 UTSW 7 97519154 missense possibly damaging 0.50
R7156:Ints4 UTSW 7 97535286 critical splice donor site probably null
R7205:Ints4 UTSW 7 97535226 nonsense probably null
R7234:Ints4 UTSW 7 97530300 missense probably benign 0.00
R7418:Ints4 UTSW 7 97490972 missense probably benign 0.03
R7423:Ints4 UTSW 7 97507719 missense probably damaging 1.00
R7462:Ints4 UTSW 7 97506128 missense probably benign 0.11
R7658:Ints4 UTSW 7 97529253 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TAAGCATAGTCCCTGTCCAGTCAG -3'
(R):5'- TGATGCACACAAAGCAGAGTATATG -3'

Sequencing Primer
(F):5'- GCTTACTGGAGCTGTTAGAGAC -3'
(R):5'- ACGCTCCTGACTCTATCA -3'
Posted On2015-06-10