Mutagenetix > Incidental Mutations

Incidental Mutation 'R4192:Ints4'

318355

Institutional Source

Beutler Lab

Gene Symbol

Ints4

Ensembl Gene

ENSMUSG00000025133

Gene Name

integrator complex subunit 4

Synonyms

2610034N24Rik

MMRRC Submission

041023-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R4192 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97480956-97541395 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 97507733 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 337 (H337Q)

Ref Sequence

ENSEMBL: ENSMUSP00000026126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026126]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026126
AA Change: H337Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026126
Gene: ENSMUSG00000025133
AA Change: H337Q

Domain	Start	End	E-Value	Type
Pfam:HEAT_2	153	258	9.8e-9	PFAM
Pfam:Cohesin_HEAT	179	219	7.7e-6	PFAM
low complexity region	518	527	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206644

Meta Mutation Damage Score

0.0744

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	G	T	14: 36,096,579	R178L	possibly damaging	Het
Acot4	T	C	12: 84,043,174		probably benign	Het
Add3	C	A	19: 53,242,524	D543E	probably benign	Het
Angpt4	A	C	2: 151,943,318	D418A	probably benign	Het
Ano8	A	T	8: 71,483,292	V260D	probably damaging	Het
Cfh	C	T	1: 140,102,716	R860H	possibly damaging	Het
Csmd3	T	C	15: 47,847,271	D1536G	probably damaging	Het
Dnajb9	A	T	12: 44,207,077	D182E	probably benign	Het
E330021D16Rik	T	C	6: 136,401,437	T132A	probably benign	Het
Epb42	G	T	2: 121,030,089		probably null	Het
Fam185a	T	A	5: 21,425,124		probably benign	Het
Fam205c	A	T	4: 42,874,185		probably benign	Het
Fer1l6	A	G	15: 58,647,149	D1710G	probably damaging	Het
Gabra2	G	A	5: 71,007,998	P210S	probably benign	Het
Gm8369	C	T	19: 11,502,232	P9S	probably damaging	Het
Il17ra	A	G	6: 120,481,511	D541G	probably damaging	Het
Itgam	A	G	7: 128,064,732	T44A	probably benign	Het
Lyst	C	A	13: 13,740,513	T3264N	probably damaging	Het
Macf1	A	G	4: 123,473,042	F1077S	possibly damaging	Het
Myo3a	T	A	2: 22,407,377	F728I	probably damaging	Het
Nacad	T	C	11: 6,605,534	E72G	probably benign	Het
Nkain3	G	A	4: 20,485,003	Q25*	probably null	Het
Oca2	T	C	7: 56,297,249	F342S	probably damaging	Het
Olfr934	T	A	9: 38,983,017	Q9L	probably benign	Het
Osbpl6	T	A	2: 76,585,229	L499Q	probably damaging	Het
Pcdhgb8	G	C	18: 37,763,541	D555H	probably damaging	Het
Peak1	A	T	9: 56,258,741	N634K	probably damaging	Het
Pitpnm3	T	C	11: 72,051,959	K818R	possibly damaging	Het
Rab3gap1	T	A	1: 127,925,470		probably benign	Het
Rcc1l	T	C	5: 134,155,809	T385A	probably benign	Het
Rrm2	T	C	12: 24,708,378	I11T	probably benign	Het
Scnn1b	A	G	7: 121,902,739	T207A	possibly damaging	Het
Syt12	T	A	19: 4,447,681		probably benign	Het
Tmprss6	A	T	15: 78,446,657		probably null	Het
Ttbk1	A	T	17: 46,479,247	C91S	probably damaging	Het
Vit	A	G	17: 78,586,826	H219R	probably benign	Het
Vmn1r27	A	C	6: 58,215,827	I14R	probably damaging	Het

Other mutations in Ints4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00765:Ints4	APN	7	97535205	missense	probably damaging	1.00
IGL01736:Ints4	APN	7	97526642	missense	probably benign	0.01
IGL01862:Ints4	APN	7	97541153	missense	probably damaging	1.00
IGL02277:Ints4	APN	7	97487458	missense	probably damaging	1.00
IGL02396:Ints4	APN	7	97537900	missense	possibly damaging	0.64
IGL02661:Ints4	APN	7	97495705	missense	probably benign
IGL02750:Ints4	APN	7	97517757	critical splice donor site	probably null
IGL03108:Ints4	APN	7	97490930	critical splice acceptor site	probably null
R0332:Ints4	UTSW	7	97517718	missense	probably damaging	1.00
R0449:Ints4	UTSW	7	97529223	missense	probably damaging	0.97
R1065:Ints4	UTSW	7	97507892	critical splice donor site	probably null
R1722:Ints4	UTSW	7	97513579	missense	probably benign	0.24
R2060:Ints4	UTSW	7	97501763	missense	possibly damaging	0.93
R2211:Ints4	UTSW	7	97509750	missense	possibly damaging	0.63
R3731:Ints4	UTSW	7	97506101	missense	probably benign	0.18
R3881:Ints4	UTSW	7	97516257	missense	possibly damaging	0.94
R4089:Ints4	UTSW	7	97529255	nonsense	probably null
R4479:Ints4	UTSW	7	97484971	missense	probably damaging	1.00
R4980:Ints4	UTSW	7	97501850	critical splice donor site	probably null
R5029:Ints4	UTSW	7	97509774	missense	probably benign	0.06
R5306:Ints4	UTSW	7	97509678	missense	probably damaging	1.00
R6160:Ints4	UTSW	7	97509583	splice site	probably null
R6317:Ints4	UTSW	7	97529218	nonsense	probably null
R6961:Ints4	UTSW	7	97541190	makesense	probably null
R7026:Ints4	UTSW	7	97519154	missense	possibly damaging	0.50
R7156:Ints4	UTSW	7	97535286	critical splice donor site	probably null
R7205:Ints4	UTSW	7	97535226	nonsense	probably null
R7234:Ints4	UTSW	7	97530300	missense	probably benign	0.00
R7418:Ints4	UTSW	7	97490972	missense	probably benign	0.03
R7423:Ints4	UTSW	7	97507719	missense	probably damaging	1.00
R7462:Ints4	UTSW	7	97506128	missense	probably benign	0.11
R7658:Ints4	UTSW	7	97529253	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TAAGCATAGTCCCTGTCCAGTCAG -3'
(R):5'- TGATGCACACAAAGCAGAGTATATG -3'

Sequencing Primer
(F):5'- GCTTACTGGAGCTGTTAGAGAC -3'
(R):5'- ACGCTCCTGACTCTATCA -3'

Posted On

2015-06-10