Incidental Mutation 'R4192:Itgam'
ID 318357
Institutional Source Beutler Lab
Gene Symbol Itgam
Ensembl Gene ENSMUSG00000030786
Gene Name integrin alpha M
Synonyms Mac-1, complement receptor type 3, Ly-40, Mac-1 alpha, CD11B (p170), Cd11b, Mac-1a, CD11b/CD18, complement component receptor 3 alpha, F730045J24Rik, CR3
MMRRC Submission 041023-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R4192 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127661812-127717663 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127663904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 44 (T44A)
Ref Sequence ENSEMBL: ENSMUSP00000121676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355] [ENSMUST00000156593]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064821
AA Change: T44A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: T44A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082743
Predicted Effect probably benign
Transcript: ENSMUST00000098015
AA Change: T44A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: T44A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106240
AA Change: T44A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: T44A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106242
AA Change: T44A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: T44A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119696
SMART Domains Protein: ENSMUSP00000113412
Gene: ENSMUSG00000030786

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:3K72|C 17 79 2e-17 PDB
SCOP:d1m1xa4 17 81 6e-18 SMART
Blast:Int_alpha 30 79 5e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120355
AA Change: T44A

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: T44A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156593
AA Change: T44A

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121676
Gene: ENSMUSG00000030786
AA Change: T44A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:3K72|C 17 79 2e-17 PDB
SCOP:d1m1xa4 17 81 9e-18 SMART
Blast:Int_alpha 30 79 3e-29 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 35,818,536 (GRCm39) R178L possibly damaging Het
Acot4 T C 12: 84,089,948 (GRCm39) probably benign Het
Add3 C A 19: 53,230,955 (GRCm39) D543E probably benign Het
Angpt4 A C 2: 151,785,238 (GRCm39) D418A probably benign Het
Ano8 A T 8: 71,935,936 (GRCm39) V260D probably damaging Het
Cfh C T 1: 140,030,454 (GRCm39) R860H possibly damaging Het
Csmd3 T C 15: 47,710,667 (GRCm39) D1536G probably damaging Het
Dnajb9 A T 12: 44,253,860 (GRCm39) D182E probably benign Het
Epb42 G T 2: 120,860,570 (GRCm39) probably null Het
Fam185a T A 5: 21,630,122 (GRCm39) probably benign Het
Fer1l6 A G 15: 58,518,998 (GRCm39) D1710G probably damaging Het
Gabra2 G A 5: 71,165,341 (GRCm39) P210S probably benign Het
Gm8369 C T 19: 11,479,596 (GRCm39) P9S probably damaging Het
Il17ra A G 6: 120,458,472 (GRCm39) D541G probably damaging Het
Ints4 T G 7: 97,156,940 (GRCm39) H337Q probably damaging Het
Lyst C A 13: 13,915,098 (GRCm39) T3264N probably damaging Het
Macf1 A G 4: 123,366,835 (GRCm39) F1077S possibly damaging Het
Myo3a T A 2: 22,412,188 (GRCm39) F728I probably damaging Het
Nacad T C 11: 6,555,534 (GRCm39) E72G probably benign Het
Nkain3 G A 4: 20,485,003 (GRCm39) Q25* probably null Het
Oca2 T C 7: 55,946,997 (GRCm39) F342S probably damaging Het
Or10d1c T A 9: 38,894,313 (GRCm39) Q9L probably benign Het
Osbpl6 T A 2: 76,415,573 (GRCm39) L499Q probably damaging Het
Pcdhgb8 G C 18: 37,896,594 (GRCm39) D555H probably damaging Het
Peak1 A T 9: 56,166,025 (GRCm39) N634K probably damaging Het
Pitpnm3 T C 11: 71,942,785 (GRCm39) K818R possibly damaging Het
Rab3gap1 T A 1: 127,853,207 (GRCm39) probably benign Het
Rcc1l T C 5: 134,184,648 (GRCm39) T385A probably benign Het
Rrm2 T C 12: 24,758,377 (GRCm39) I11T probably benign Het
Scnn1b A G 7: 121,501,962 (GRCm39) T207A possibly damaging Het
Spata31f3 A T 4: 42,874,185 (GRCm39) probably benign Het
Syt12 T A 19: 4,497,709 (GRCm39) probably benign Het
Tmprss6 A T 15: 78,330,857 (GRCm39) probably null Het
Ttbk1 A T 17: 46,790,173 (GRCm39) C91S probably damaging Het
Ube2q2l T C 6: 136,378,435 (GRCm39) T132A probably benign Het
Vit A G 17: 78,894,255 (GRCm39) H219R probably benign Het
Vmn1r27 A C 6: 58,192,812 (GRCm39) I14R probably damaging Het
Other mutations in Itgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 127,684,833 (GRCm39) missense probably damaging 1.00
IGL00983:Itgam APN 7 127,667,839 (GRCm39) missense probably damaging 0.97
IGL01102:Itgam APN 7 127,679,445 (GRCm39) missense possibly damaging 0.94
IGL01615:Itgam APN 7 127,715,939 (GRCm39) missense possibly damaging 0.80
IGL01845:Itgam APN 7 127,711,644 (GRCm39) missense probably damaging 1.00
IGL01860:Itgam APN 7 127,670,115 (GRCm39) missense probably benign 0.03
IGL01874:Itgam APN 7 127,714,338 (GRCm39) missense probably damaging 0.97
IGL01910:Itgam APN 7 127,682,948 (GRCm39) missense probably damaging 1.00
IGL01994:Itgam APN 7 127,700,899 (GRCm39) missense probably damaging 0.97
IGL02332:Itgam APN 7 127,684,846 (GRCm39) critical splice donor site probably null
IGL02348:Itgam APN 7 127,715,472 (GRCm39) missense possibly damaging 0.52
IGL02394:Itgam APN 7 127,684,114 (GRCm39) missense probably benign 0.01
IGL02491:Itgam APN 7 127,715,190 (GRCm39) missense possibly damaging 0.71
IGL02695:Itgam APN 7 127,685,113 (GRCm39) missense possibly damaging 0.81
IGL02821:Itgam APN 7 127,675,281 (GRCm39) missense probably damaging 0.99
IGL02970:Itgam APN 7 127,685,215 (GRCm39) missense probably benign 0.00
IGL03145:Itgam APN 7 127,712,191 (GRCm39) missense probably benign 0.12
adhesion UTSW 7 127,700,709 (GRCm39) missense probably damaging 0.99
apparition UTSW 7 127,711,458 (GRCm39) splice site probably null
attachment UTSW 7 127,712,205 (GRCm39) missense probably damaging 1.00
Follower UTSW 7 127,679,436 (GRCm39) missense probably damaging 1.00
invisible UTSW 7 127,669,875 (GRCm39) splice site probably null
obscured UTSW 7 127,680,806 (GRCm39) missense probably damaging 1.00
R0184:Itgam UTSW 7 127,685,230 (GRCm39) missense probably damaging 0.96
R0389:Itgam UTSW 7 127,680,806 (GRCm39) missense probably damaging 1.00
R0443:Itgam UTSW 7 127,680,806 (GRCm39) missense probably damaging 1.00
R0454:Itgam UTSW 7 127,707,152 (GRCm39) missense probably benign 0.01
R0674:Itgam UTSW 7 127,715,390 (GRCm39) missense possibly damaging 0.67
R0828:Itgam UTSW 7 127,715,677 (GRCm39) critical splice donor site probably null
R0925:Itgam UTSW 7 127,711,410 (GRCm39) missense probably benign 0.00
R1086:Itgam UTSW 7 127,679,436 (GRCm39) missense probably damaging 1.00
R1655:Itgam UTSW 7 127,714,335 (GRCm39) missense probably benign 0.00
R1809:Itgam UTSW 7 127,670,109 (GRCm39) missense possibly damaging 0.62
R1823:Itgam UTSW 7 127,663,904 (GRCm39) missense probably benign 0.04
R2105:Itgam UTSW 7 127,680,884 (GRCm39) missense probably damaging 1.00
R2154:Itgam UTSW 7 127,684,749 (GRCm39) missense probably damaging 0.99
R2656:Itgam UTSW 7 127,715,987 (GRCm39) missense probably null 1.00
R2913:Itgam UTSW 7 127,711,578 (GRCm39) missense probably damaging 1.00
R3116:Itgam UTSW 7 127,715,201 (GRCm39) missense probably damaging 1.00
R3404:Itgam UTSW 7 127,669,875 (GRCm39) splice site probably null
R3821:Itgam UTSW 7 127,711,458 (GRCm39) splice site probably null
R3822:Itgam UTSW 7 127,711,458 (GRCm39) splice site probably null
R3960:Itgam UTSW 7 127,714,347 (GRCm39) missense probably benign 0.02
R3968:Itgam UTSW 7 127,712,205 (GRCm39) missense probably damaging 1.00
R4400:Itgam UTSW 7 127,680,830 (GRCm39) missense probably damaging 1.00
R4708:Itgam UTSW 7 127,700,709 (GRCm39) missense probably damaging 0.99
R4709:Itgam UTSW 7 127,700,709 (GRCm39) missense probably damaging 0.99
R4742:Itgam UTSW 7 127,712,245 (GRCm39) missense probably damaging 1.00
R4790:Itgam UTSW 7 127,715,445 (GRCm39) missense probably benign 0.01
R4960:Itgam UTSW 7 127,715,012 (GRCm39) missense possibly damaging 0.93
R5109:Itgam UTSW 7 127,712,390 (GRCm39) missense probably benign 0.06
R5190:Itgam UTSW 7 127,715,489 (GRCm39) splice site probably null
R5379:Itgam UTSW 7 127,711,560 (GRCm39) missense probably damaging 1.00
R5386:Itgam UTSW 7 127,707,152 (GRCm39) missense probably benign 0.00
R6104:Itgam UTSW 7 127,715,474 (GRCm39) missense possibly damaging 0.85
R6122:Itgam UTSW 7 127,684,824 (GRCm39) missense probably damaging 0.99
R6189:Itgam UTSW 7 127,711,676 (GRCm39) missense probably benign 0.04
R6282:Itgam UTSW 7 127,684,114 (GRCm39) missense probably benign 0.01
R6545:Itgam UTSW 7 127,707,044 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGACAGGAATGGTCAC -3'
(R):5'- GACTCCTGAAACCTTACTACTGATTC -3'

Sequencing Primer
(F):5'- ATGGTCACGGGTGGAAATGTG -3'
(R):5'- GAGCATCTGCAAACCTTGGATTC -3'
Posted On 2015-06-10