Incidental Mutation 'R4192:Ano8'
ID318358
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Nameanoctamin 8
SynonymsTmem16h
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71476019-71485963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71483292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 260 (V260D)
Ref Sequence ENSEMBL: ENSMUSP00000091157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000168847] [ENSMUST00000213382]
Predicted Effect probably benign
Transcript: ENSMUST00000007754
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093450
AA Change: V260D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863
AA Change: V260D

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168847
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect probably damaging
Transcript: ENSMUST00000213382
AA Change: V260D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71484258 splice site probably benign
IGL00501:Ano8 APN 8 71479149 critical splice donor site probably null
IGL01380:Ano8 APN 8 71480809 unclassified probably benign
IGL02138:Ano8 APN 8 71484842 missense probably damaging 0.99
IGL02516:Ano8 APN 8 71485077 missense probably damaging 1.00
IGL02675:Ano8 APN 8 71483540 missense probably damaging 0.99
IGL02995:Ano8 APN 8 71483117 missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71478744 unclassified probably benign
R0265:Ano8 UTSW 8 71480524 unclassified probably benign
R0282:Ano8 UTSW 8 71480614 unclassified probably benign
R0518:Ano8 UTSW 8 71479258 missense probably benign 0.39
R0521:Ano8 UTSW 8 71479258 missense probably benign 0.39
R1028:Ano8 UTSW 8 71480971 small deletion probably benign
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1748:Ano8 UTSW 8 71478958 unclassified probably benign
R1852:Ano8 UTSW 8 71483487 missense probably damaging 0.99
R4161:Ano8 UTSW 8 71482637 missense probably damaging 1.00
R4274:Ano8 UTSW 8 71478741 unclassified probably benign
R4834:Ano8 UTSW 8 71484295 missense probably damaging 1.00
R4961:Ano8 UTSW 8 71482996 missense probably damaging 1.00
R5252:Ano8 UTSW 8 71482617 missense probably damaging 1.00
R5553:Ano8 UTSW 8 71484997 splice site probably null
R5598:Ano8 UTSW 8 71482577 missense probably damaging 1.00
R5695:Ano8 UTSW 8 71483243 missense probably damaging 0.98
R5994:Ano8 UTSW 8 71484834 missense probably damaging 1.00
R6019:Ano8 UTSW 8 71482380 missense probably damaging 1.00
R6153:Ano8 UTSW 8 71480797 unclassified probably benign
R6405:Ano8 UTSW 8 71483030 missense probably damaging 1.00
R6516:Ano8 UTSW 8 71481780 splice site probably null
R6539:Ano8 UTSW 8 71484483 missense probably damaging 1.00
R7194:Ano8 UTSW 8 71482363 missense possibly damaging 0.66
R7204:Ano8 UTSW 8 71479025 missense probably benign 0.39
R7340:Ano8 UTSW 8 71483011 missense probably damaging 0.99
R7365:Ano8 UTSW 8 71485110 missense probably damaging 1.00
R7417:Ano8 UTSW 8 71480833 missense unknown
R7486:Ano8 UTSW 8 71484998 critical splice donor site probably null
R7644:Ano8 UTSW 8 71484830 missense probably damaging 0.98
R7709:Ano8 UTSW 8 71482289 missense probably damaging 1.00
R7719:Ano8 UTSW 8 71483140 missense possibly damaging 0.82
R8040:Ano8 UTSW 8 71482168 missense probably benign 0.26
R8219:Ano8 UTSW 8 71480713 missense unknown
R8355:Ano8 UTSW 8 71480566 unclassified probably benign
R8401:Ano8 UTSW 8 71483367 missense probably damaging 1.00
R8713:Ano8 UTSW 8 71485077 missense probably damaging 1.00
R8755:Ano8 UTSW 8 71483080 missense probably benign 0.11
R8871:Ano8 UTSW 8 71479300 missense probably benign 0.39
X0026:Ano8 UTSW 8 71479157 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAACATCCCGGCTTGTCTG -3'
(R):5'- GTTTCCAGTTCACGAGCAGC -3'

Sequencing Primer
(F):5'- CATCCCGGCTTGTCTGTAGGTAG -3'
(R):5'- CGAGCAGCGTATTCTGAATCGTC -3'
Posted On2015-06-10