Incidental Mutation 'R4192:Olfr934'
ID318359
Institutional Source Beutler Lab
Gene Symbol Olfr934
Ensembl Gene ENSMUSG00000057424
Gene Nameolfactory receptor 934
SynonymsMOR224-6, GA_x6K02T2PVTD-32678895-32677963
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38981026-38988315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38983017 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 9 (Q9L)
Ref Sequence ENSEMBL: ENSMUSP00000150864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074211] [ENSMUST00000214324] [ENSMUST00000216238] [ENSMUST00000216823]
Predicted Effect probably benign
Transcript: ENSMUST00000074211
AA Change: Q9L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073835
Gene: ENSMUSG00000057424
AA Change: Q9L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 222 7.2e-9 PFAM
Pfam:7tm_1 39 286 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214324
AA Change: Q9L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216238
Predicted Effect probably benign
Transcript: ENSMUST00000216823
AA Change: Q9L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Olfr934
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Olfr934 APN 9 38982546 missense possibly damaging 0.71
R1061:Olfr934 UTSW 9 38982483 missense probably damaging 1.00
R1604:Olfr934 UTSW 9 38982618 missense probably benign 0.01
R1776:Olfr934 UTSW 9 38982894 missense probably damaging 1.00
R3499:Olfr934 UTSW 9 38982465 missense probably damaging 1.00
R3761:Olfr934 UTSW 9 38982366 missense possibly damaging 0.94
R3876:Olfr934 UTSW 9 38982870 missense probably damaging 1.00
R4191:Olfr934 UTSW 9 38983017 missense probably benign 0.01
R4333:Olfr934 UTSW 9 38982588 missense possibly damaging 0.85
R4876:Olfr934 UTSW 9 38982626 nonsense probably null
R5539:Olfr934 UTSW 9 38982277 missense possibly damaging 0.85
R6916:Olfr934 UTSW 9 38982904 missense probably benign 0.14
R7097:Olfr934 UTSW 9 38982618 missense probably benign 0.01
R7338:Olfr934 UTSW 9 38982520 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCACACACTGACAGCTGGC -3'
(R):5'- GTTCAAATCAAGGTTGGACTTTTG -3'

Sequencing Primer
(F):5'- TGGCACAGGAAGAAGTACATG -3'
(R):5'- CTTTTGTCCAACTCAGCAAAAACTG -3'
Posted On2015-06-10