Incidental Mutation 'R4192:Rrm2'
ID318364
Institutional Source Beutler Lab
Gene Symbol Rrm2
Ensembl Gene ENSMUSG00000020649
Gene Nameribonucleotide reductase M2
SynonymsR2
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4192 (G1)
Quality Score177
Status Validated
Chromosome12
Chromosomal Location24708241-24714146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24708378 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 11 (I11T)
Ref Sequence ENSEMBL: ENSMUSP00000020980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020980] [ENSMUST00000153058] [ENSMUST00000154588]
PDB Structure
SMALL SUBUNIT C-TERMINAL INHIBITORY PEPTIDE OF MOUSE RIBONUCLEOTIDE REDUCTASE AS BOUND TO THE LARGE SUBUNIT, NMR, 26 STRUCTURES [SOLUTION NMR]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER OXIDIZING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER REDUCING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER AND BOUND ACETATE. [X-RAY DIFFRACTION]
PROTEIN R2 OF RIBONUCLEOTIDE REDUCTASE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020980
AA Change: I11T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020980
Gene: ENSMUSG00000020649
AA Change: I11T

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 80 347 1.6e-124 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147789
Predicted Effect probably benign
Transcript: ENSMUST00000153058
SMART Domains Protein: ENSMUSP00000120893
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ribonuc_red_sm 40 225 2.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154588
SMART Domains Protein: ENSMUSP00000119502
Gene: ENSMUSG00000020649

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 1 181 2.7e-88 PFAM
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Rrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Rrm2 APN 12 24711439 splice site probably benign
IGL02361:Rrm2 APN 12 24711439 splice site probably benign
IGL02957:Rrm2 APN 12 24708441 missense probably damaging 0.99
R1804:Rrm2 UTSW 12 24708612 missense probably benign 0.42
R1854:Rrm2 UTSW 12 24713152 missense probably damaging 1.00
R3826:Rrm2 UTSW 12 24708599 missense probably benign
R3827:Rrm2 UTSW 12 24708599 missense probably benign
R3828:Rrm2 UTSW 12 24708599 missense probably benign
R3830:Rrm2 UTSW 12 24708599 missense probably benign
R3851:Rrm2 UTSW 12 24708599 missense probably benign
R3938:Rrm2 UTSW 12 24709432 missense probably damaging 1.00
R4042:Rrm2 UTSW 12 24711451 missense probably benign 0.00
R5274:Rrm2 UTSW 12 24710407 nonsense probably null
R8375:Rrm2 UTSW 12 24712752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAAATCTCCCGCGCTG -3'
(R):5'- TCCTGGAAGATTCTCCTCGCAG -3'

Sequencing Primer
(F):5'- TCAGCGGCGTCCAATGG -3'
(R):5'- GGAAGATTCTCCTCGCAGCTTTG -3'
Posted On2015-06-10