Incidental Mutation 'R4192:Dnajb9'
ID318365
Institutional Source Beutler Lab
Gene Symbol Dnajb9
Ensembl Gene ENSMUSG00000014905
Gene NameDnaJ heat shock protein family (Hsp40) member B9
SynonymsmDj7, Mdg1, microvascular endothelial differentiation gene, ERdj4
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location44205559-44210326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44207077 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 182 (D182E)
Ref Sequence ENSEMBL: ENSMUSP00000015049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015049] [ENSMUST00000220421]
Predicted Effect probably benign
Transcript: ENSMUST00000015049
AA Change: D182E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000015049
Gene: ENSMUSG00000014905
AA Change: D182E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
DnaJ 25 82 2.55e-29 SMART
low complexity region 111 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219471
Predicted Effect probably benign
Transcript: ENSMUST00000220421
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele show perinatal death, reduced birth size and liver glycogen levels, and hypoglycemia. Surviving adults show elevated ER stress in MEFs, lung, kidney, salivary gland and in pancreas, associated with beta cell loss, hypoinsulinemia, and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Dnajb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb9 APN 12 44207086 missense possibly damaging 0.72
IGL02093:Dnajb9 APN 12 44207204 missense probably damaging 0.99
IGL03383:Dnajb9 APN 12 44208313 splice site probably benign
R0355:Dnajb9 UTSW 12 44207204 missense probably damaging 0.98
R0595:Dnajb9 UTSW 12 44208284 missense probably benign 0.00
R2191:Dnajb9 UTSW 12 44207073 missense probably benign
R7574:Dnajb9 UTSW 12 44207386 missense probably damaging 1.00
X0067:Dnajb9 UTSW 12 44207333 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGCTTAACATAAGTGAAATCATGC -3'
(R):5'- AGGCAATGGGAGTCCTTTTG -3'

Sequencing Primer
(F):5'- CATGCATTTACCAAAATAGTTCACAG -3'
(R):5'- CAATGGGAGTCCTTTTGAACAGTC -3'
Posted On2015-06-10