Incidental Mutation 'R4192:Acot4'
ID318366
Institutional Source Beutler Lab
Gene Symbol Acot4
Ensembl Gene ENSMUSG00000052392
Gene Nameacyl-CoA thioesterase 4
SynonymsB430212I04Rik, Pte2b, PTE-Ib
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4192 (G1)
Quality Score132
Status Validated
Chromosome12
Chromosomal Location84038379-84048601 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 84043174 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021652]
Predicted Effect probably benign
Transcript: ENSMUST00000021652
SMART Domains Protein: ENSMUSP00000021652
Gene: ENSMUSG00000052392

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 3.4e-43 PFAM
low complexity region 148 159 N/A INTRINSIC
Pfam:Abhydrolase_5 162 361 1e-6 PFAM
Pfam:FSH1 193 364 3.5e-5 PFAM
Pfam:BAAT_C 203 412 1.1e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180751
Predicted Effect probably benign
Transcript: ENSMUST00000221229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221860
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Acot4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Acot4 APN 12 84042025 missense probably damaging 0.98
IGL02806:Acot4 APN 12 84041963 missense probably damaging 1.00
IGL02967:Acot4 APN 12 84043461 missense probably benign
R1827:Acot4 UTSW 12 84041938 missense probably damaging 1.00
R2105:Acot4 UTSW 12 84038742 missense probably damaging 1.00
R2509:Acot4 UTSW 12 84041873 missense probably damaging 1.00
R2904:Acot4 UTSW 12 84043603 missense probably benign 0.31
R3859:Acot4 UTSW 12 84043444 missense probably benign 0.17
R3904:Acot4 UTSW 12 84043327 splice site probably null
R4190:Acot4 UTSW 12 84043174 intron probably benign
R4541:Acot4 UTSW 12 84043248 missense probably benign 0.38
R5061:Acot4 UTSW 12 84038701 missense probably benign 0.03
R5682:Acot4 UTSW 12 84038802 missense probably damaging 1.00
R5864:Acot4 UTSW 12 84043404 missense probably benign 0.04
R6818:Acot4 UTSW 12 84042009 missense probably damaging 1.00
R7699:Acot4 UTSW 12 84043237 missense probably damaging 1.00
R7700:Acot4 UTSW 12 84043237 missense probably damaging 1.00
R8260:Acot4 UTSW 12 84042035 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCTTTGGTGCTCGGTAAC -3'
(R):5'- AACGGCGGAATCATGGTCTG -3'

Sequencing Primer
(F):5'- GGACAACTTGCAAGAGTCAGTTCTC -3'
(R):5'- CGGAATCATGGTCTGCTTGTAC -3'
Posted On2015-06-10