Incidental Mutation 'R4192:4930474N05Rik'
ID318368
Institutional Source Beutler Lab
Gene Symbol 4930474N05Rik
Ensembl Gene ENSMUSG00000096405
Gene NameRIKEN cDNA 4930474N05 gene
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location36094917-36100114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36096579 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 178 (R178L)
Ref Sequence ENSEMBL: ENSMUSP00000153709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177985] [ENSMUST00000186722] [ENSMUST00000226305]
Predicted Effect probably benign
Transcript: ENSMUST00000177985
SMART Domains Protein: ENSMUSP00000136756
Gene: ENSMUSG00000096405

DomainStartEndE-ValueType
RasGEFN 65 184 3.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186722
Predicted Effect possibly damaging
Transcript: ENSMUST00000226305
AA Change: R178L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.4242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in 4930474N05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:4930474N05Rik APN 14 36096422 missense possibly damaging 0.54
IGL01694:4930474N05Rik APN 14 36096702 makesense probably null
IGL02821:4930474N05Rik APN 14 36096516 missense probably benign 0.19
R0071:4930474N05Rik UTSW 14 36090789 unclassified probably benign
R0537:4930474N05Rik UTSW 14 36096700 missense probably benign 0.07
R0960:4930474N05Rik UTSW 14 36096410 missense probably benign 0.01
R1919:4930474N05Rik UTSW 14 36095457 missense possibly damaging 0.48
R2338:4930474N05Rik UTSW 14 36095152 missense probably benign
R3837:4930474N05Rik UTSW 14 36095478 missense probably benign 0.03
R4193:4930474N05Rik UTSW 14 36096579 missense possibly damaging 0.94
R4526:4930474N05Rik UTSW 14 36096578 missense probably damaging 1.00
R7007:4930474N05Rik UTSW 14 36095164 missense probably benign 0.18
R7302:4930474N05Rik UTSW 14 36095349 missense probably benign 0.00
R7998:4930474N05Rik UTSW 14 36096692 missense probably benign 0.22
R8202:4930474N05Rik UTSW 14 36095100 missense probably benign 0.01
R8714:4930474N05Rik UTSW 14 36096499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGGGACTTTACAGGTGATATTC -3'
(R):5'- TCGACTTCCAAGATGGCTGG -3'

Sequencing Primer
(F):5'- ACAGGTGATATTCTGTCTGGTC -3'
(R):5'- GACTTCCAAGATGGCTGGTTTCTTC -3'
Posted On2015-06-10