Incidental Mutation 'R4192:Syt12'
ID 318376
Institutional Source Beutler Lab
Gene Symbol Syt12
Ensembl Gene ENSMUSG00000049303
Gene Name synaptotagmin XII
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4192 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 4445908-4477447 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to A at 4447681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059295]
AlphaFold Q920N7
Predicted Effect probably benign
Transcript: ENSMUST00000059295
SMART Domains Protein: ENSMUSP00000055237
Gene: ENSMUSG00000049303

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
C2 168 272 1.8e-6 SMART
C2 299 405 4.9e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154407
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Syt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt12 APN 19 4447845 missense probably damaging 0.99
IGL02045:Syt12 APN 19 4447734 missense probably damaging 1.00
IGL02942:Syt12 APN 19 4447830 missense probably benign 0.16
IGL03131:Syt12 APN 19 4456854 missense probably benign
R1308:Syt12 UTSW 19 4460735 missense probably damaging 0.99
R1830:Syt12 UTSW 19 4456883 missense probably benign
R1858:Syt12 UTSW 19 4447797 missense probably damaging 1.00
R5646:Syt12 UTSW 19 4456541 missense possibly damaging 0.54
R5769:Syt12 UTSW 19 4451044 missense probably damaging 1.00
R5785:Syt12 UTSW 19 4450994 missense possibly damaging 0.95
R6079:Syt12 UTSW 19 4456868 missense probably benign
R7017:Syt12 UTSW 19 4460867 splice site probably null
R7043:Syt12 UTSW 19 4451021 missense probably benign 0.04
R7137:Syt12 UTSW 19 4453950 missense probably damaging 1.00
R7935:Syt12 UTSW 19 4447802 missense probably benign 0.06
R8042:Syt12 UTSW 19 4453824 missense probably damaging 0.98
R9468:Syt12 UTSW 19 4447716 missense probably damaging 1.00
U15987:Syt12 UTSW 19 4456868 missense probably benign
Z1177:Syt12 UTSW 19 4453928 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCTTCCATGACAGTCTGGACAG -3'
(R):5'- GAACCCTTTAGCTGCTCCTG -3'

Sequencing Primer
(F):5'- CATGACAGTCTGGACAGAGGATCC -3'
(R):5'- AGGACCTGTCTCTCCGGGTG -3'
Posted On 2015-06-10