Incidental Mutation 'R4192:Add3'
ID 318378
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Name adducin 3
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4192 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 53128874-53235518 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53230955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 543 (D543E)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
AlphaFold Q9QYB5
Predicted Effect probably benign
Transcript: ENSMUST00000025999
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050096
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111741
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 35,818,536 (GRCm39) R178L possibly damaging Het
Acot4 T C 12: 84,089,948 (GRCm39) probably benign Het
Angpt4 A C 2: 151,785,238 (GRCm39) D418A probably benign Het
Ano8 A T 8: 71,935,936 (GRCm39) V260D probably damaging Het
Cfh C T 1: 140,030,454 (GRCm39) R860H possibly damaging Het
Csmd3 T C 15: 47,710,667 (GRCm39) D1536G probably damaging Het
Dnajb9 A T 12: 44,253,860 (GRCm39) D182E probably benign Het
Epb42 G T 2: 120,860,570 (GRCm39) probably null Het
Fam185a T A 5: 21,630,122 (GRCm39) probably benign Het
Fer1l6 A G 15: 58,518,998 (GRCm39) D1710G probably damaging Het
Gabra2 G A 5: 71,165,341 (GRCm39) P210S probably benign Het
Gm8369 C T 19: 11,479,596 (GRCm39) P9S probably damaging Het
Il17ra A G 6: 120,458,472 (GRCm39) D541G probably damaging Het
Ints4 T G 7: 97,156,940 (GRCm39) H337Q probably damaging Het
Itgam A G 7: 127,663,904 (GRCm39) T44A probably benign Het
Lyst C A 13: 13,915,098 (GRCm39) T3264N probably damaging Het
Macf1 A G 4: 123,366,835 (GRCm39) F1077S possibly damaging Het
Myo3a T A 2: 22,412,188 (GRCm39) F728I probably damaging Het
Nacad T C 11: 6,555,534 (GRCm39) E72G probably benign Het
Nkain3 G A 4: 20,485,003 (GRCm39) Q25* probably null Het
Oca2 T C 7: 55,946,997 (GRCm39) F342S probably damaging Het
Or10d1c T A 9: 38,894,313 (GRCm39) Q9L probably benign Het
Osbpl6 T A 2: 76,415,573 (GRCm39) L499Q probably damaging Het
Pcdhgb8 G C 18: 37,896,594 (GRCm39) D555H probably damaging Het
Peak1 A T 9: 56,166,025 (GRCm39) N634K probably damaging Het
Pitpnm3 T C 11: 71,942,785 (GRCm39) K818R possibly damaging Het
Rab3gap1 T A 1: 127,853,207 (GRCm39) probably benign Het
Rcc1l T C 5: 134,184,648 (GRCm39) T385A probably benign Het
Rrm2 T C 12: 24,758,377 (GRCm39) I11T probably benign Het
Scnn1b A G 7: 121,501,962 (GRCm39) T207A possibly damaging Het
Spata31f3 A T 4: 42,874,185 (GRCm39) probably benign Het
Syt12 T A 19: 4,497,709 (GRCm39) probably benign Het
Tmprss6 A T 15: 78,330,857 (GRCm39) probably null Het
Ttbk1 A T 17: 46,790,173 (GRCm39) C91S probably damaging Het
Ube2q2l T C 6: 136,378,435 (GRCm39) T132A probably benign Het
Vit A G 17: 78,894,255 (GRCm39) H219R probably benign Het
Vmn1r27 A C 6: 58,192,812 (GRCm39) I14R probably damaging Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53,227,861 (GRCm39) missense probably damaging 1.00
IGL02177:Add3 APN 19 53,205,323 (GRCm39) nonsense probably null
IGL03093:Add3 APN 19 53,219,638 (GRCm39) missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53,231,022 (GRCm39) missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53,225,121 (GRCm39) missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53,205,298 (GRCm39) missense unknown
R0087:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R0335:Add3 UTSW 19 53,225,259 (GRCm39) missense probably benign 0.00
R0346:Add3 UTSW 19 53,205,387 (GRCm39) nonsense probably null
R0514:Add3 UTSW 19 53,225,274 (GRCm39) nonsense probably null
R0692:Add3 UTSW 19 53,205,383 (GRCm39) missense probably damaging 1.00
R1437:Add3 UTSW 19 53,222,109 (GRCm39) missense probably damaging 0.98
R1747:Add3 UTSW 19 53,230,981 (GRCm39) missense probably benign 0.41
R2926:Add3 UTSW 19 53,215,253 (GRCm39) splice site probably null
R4780:Add3 UTSW 19 53,223,223 (GRCm39) missense possibly damaging 0.64
R5019:Add3 UTSW 19 53,231,002 (GRCm39) missense probably damaging 0.99
R5486:Add3 UTSW 19 53,232,818 (GRCm39) missense probably benign 0.00
R5526:Add3 UTSW 19 53,215,038 (GRCm39) missense probably damaging 1.00
R5580:Add3 UTSW 19 53,233,642 (GRCm39) missense probably damaging 1.00
R5851:Add3 UTSW 19 53,225,205 (GRCm39) missense probably damaging 1.00
R5863:Add3 UTSW 19 53,222,301 (GRCm39) missense probably benign 0.00
R5951:Add3 UTSW 19 53,232,720 (GRCm39) splice site probably null
R6229:Add3 UTSW 19 53,223,277 (GRCm39) missense probably benign 0.35
R7017:Add3 UTSW 19 53,222,284 (GRCm39) missense possibly damaging 0.94
R7190:Add3 UTSW 19 53,205,330 (GRCm39) nonsense probably null
R7222:Add3 UTSW 19 53,205,277 (GRCm39) missense unknown
R7231:Add3 UTSW 19 53,221,577 (GRCm39) missense probably benign 0.00
R7532:Add3 UTSW 19 53,220,589 (GRCm39) missense probably damaging 1.00
R7557:Add3 UTSW 19 53,227,868 (GRCm39) missense probably damaging 0.98
R7726:Add3 UTSW 19 53,227,892 (GRCm39) missense probably damaging 1.00
R9063:Add3 UTSW 19 53,222,302 (GRCm39) missense probably damaging 0.98
R9069:Add3 UTSW 19 53,222,332 (GRCm39) missense possibly damaging 0.92
R9371:Add3 UTSW 19 53,221,499 (GRCm39) missense probably damaging 1.00
R9550:Add3 UTSW 19 53,233,521 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTATGAAGTTGGGTAATCACAAAC -3'
(R):5'- TGGACTGCAGAGTGGTTCTC -3'

Sequencing Primer
(F):5'- ACAAACGTTTATTTTGTGTGTATGC -3'
(R):5'- TTCTCTATGGAAAGGTCTAGAGCAG -3'
Posted On 2015-06-10