Incidental Mutation 'R4192:Add3'
ID318378
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Nameadducin 3 (gamma)
Synonyms
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53140445-53247399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53242524 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 543 (D543E)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
Predicted Effect probably benign
Transcript: ENSMUST00000025999
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050096
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111741
AA Change: D543E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: D543E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53239430 missense probably damaging 1.00
IGL02177:Add3 APN 19 53216892 nonsense probably null
IGL03093:Add3 APN 19 53231207 missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53242591 missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53236690 missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53216867 missense unknown
R0087:Add3 UTSW 19 53226607 missense probably damaging 1.00
R0335:Add3 UTSW 19 53236828 missense probably benign 0.00
R0346:Add3 UTSW 19 53216956 nonsense probably null
R0514:Add3 UTSW 19 53236843 nonsense probably null
R0692:Add3 UTSW 19 53216952 missense probably damaging 1.00
R1437:Add3 UTSW 19 53233678 missense probably damaging 0.98
R1747:Add3 UTSW 19 53242550 missense probably benign 0.41
R2926:Add3 UTSW 19 53226822 intron probably null
R4780:Add3 UTSW 19 53234792 missense possibly damaging 0.64
R5019:Add3 UTSW 19 53242571 missense probably damaging 0.99
R5486:Add3 UTSW 19 53244387 missense probably benign 0.00
R5526:Add3 UTSW 19 53226607 missense probably damaging 1.00
R5580:Add3 UTSW 19 53245211 missense probably damaging 1.00
R5851:Add3 UTSW 19 53236774 missense probably damaging 1.00
R5863:Add3 UTSW 19 53233870 missense probably benign 0.00
R5951:Add3 UTSW 19 53244289 intron probably null
R6229:Add3 UTSW 19 53234846 missense probably benign 0.35
R7017:Add3 UTSW 19 53233853 missense possibly damaging 0.94
R7190:Add3 UTSW 19 53216899 nonsense probably null
R7222:Add3 UTSW 19 53216846 missense unknown
R7231:Add3 UTSW 19 53233146 missense probably benign 0.00
R7532:Add3 UTSW 19 53232158 missense probably damaging 1.00
R7557:Add3 UTSW 19 53239437 missense probably damaging 0.98
R7726:Add3 UTSW 19 53239461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGAAGTTGGGTAATCACAAAC -3'
(R):5'- TGGACTGCAGAGTGGTTCTC -3'

Sequencing Primer
(F):5'- ACAAACGTTTATTTTGTGTGTATGC -3'
(R):5'- TTCTCTATGGAAAGGTCTAGAGCAG -3'
Posted On2015-06-10