Mutagenetix > Incidental Mutation

Incidental Mutation 'R0394:Cenpe'

31840

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

038600-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0394 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 135216425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062893

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.0%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 138,067,304	S751R	probably damaging	Het
4933417A18Rik	T	C	13: 34,932,653		probably benign	Het
Abca8a	A	G	11: 110,026,343	V1610A	probably damaging	Het
Actl10	A	T	2: 154,553,037	H202L	probably benign	Het
Alox12	A	T	11: 70,245,935	V489E	probably damaging	Het
Ap4m1	T	A	5: 138,172,203	F5I	probably benign	Het
Atn1	T	C	6: 124,749,733		probably benign	Het
Atrnl1	T	A	19: 57,673,176	N529K	probably benign	Het
B3gntl1	C	T	11: 121,619,715	G336D	probably damaging	Het
Bmp1	G	A	14: 70,490,034	A703V	probably damaging	Het
Brat1	T	G	5: 140,718,386	L798R	probably damaging	Het
Cacna1c	C	T	6: 118,625,497	G1302R	probably damaging	Het
Cdr2	A	T	7: 120,958,731	D190E	probably benign	Het
Clstn1	A	G	4: 149,644,178	D687G	probably benign	Het
Coro1a	A	G	7: 126,700,640	F337L	probably benign	Het
Ddx49	T	A	8: 70,296,925	I252F	probably damaging	Het
Dennd2a	T	A	6: 39,522,812	D273V	possibly damaging	Het
Derl2	A	T	11: 71,014,561	F32I	probably benign	Het
Dmrta1	A	G	4: 89,692,039	Y412C	probably damaging	Het
Dsg1a	A	G	18: 20,333,750	N559S	probably damaging	Het
Dusp26	G	T	8: 31,091,959	R27L	probably benign	Het
Eif2ak3	T	C	6: 70,885,218	I492T	probably benign	Het
Exoc7	G	T	11: 116,300,398	Q219K	probably damaging	Het
F2r	T	C	13: 95,604,476	T184A	probably damaging	Het
Fbf1	G	A	11: 116,152,462		probably benign	Het
Fbxo28	A	G	1: 182,317,015	M328T	probably benign	Het
Fsip2	T	A	2: 82,991,075	D5717E	possibly damaging	Het
Gnpat	C	A	8: 124,880,225	S373R	possibly damaging	Het
Golgb1	G	T	16: 36,875,579		probably benign	Het
Greb1l	T	C	18: 10,523,374	V844A	probably damaging	Het
Hps1	G	T	19: 42,770,899		probably null	Het
Inppl1	G	T	7: 101,828,195		probably benign	Het
Isca1	C	T	13: 59,758,885		probably null	Het
Itgb2	T	A	10: 77,542,475	C46S	probably damaging	Het
Kifc5b	C	T	17: 26,923,082	T178M	probably benign	Het
Krt80	T	C	15: 101,352,299	T22A	probably damaging	Het
L3mbtl2	C	T	15: 81,668,741	A125V	probably damaging	Het
Ltbp2	C	T	12: 84,806,424		probably benign	Het
Mettl18	A	G	1: 163,996,341	D77G	probably benign	Het
Mfsd2a	A	G	4: 122,950,168	L336P	probably benign	Het
Mgat4b	A	G	11: 50,230,919		probably null	Het
Mtmr14	C	T	6: 113,280,688	R233*	probably null	Het
Nbea	T	C	3: 56,029,907	Y761C	probably damaging	Het
Neb	A	T	2: 52,177,559		probably null	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Olfr814	T	A	10: 129,873,942	I272L	probably benign	Het
Oxr1	T	A	15: 41,817,197	M177K	probably damaging	Het
Pgm2l1	A	G	7: 100,252,198	Y98C	probably damaging	Het
Pi4kb	G	T	3: 94,996,804		probably benign	Het
Pi4kb	G	A	3: 94,996,805		probably benign	Het
Pirb	T	A	7: 3,719,248	S199C	probably benign	Het
Prss23	A	C	7: 89,509,847	I338S	probably damaging	Het
Rapgef3	A	T	15: 97,757,819		probably benign	Het
Rdh7	T	A	10: 127,884,670	T278S	probably benign	Het
Rnf219	T	C	14: 104,478,853	R695G	possibly damaging	Het
Rrp1b	A	G	17: 32,058,564	D606G	probably benign	Het
Rxfp1	T	A	3: 79,652,377	Y379F	possibly damaging	Het
Rxfp2	T	C	5: 150,067,388	V514A	probably benign	Het
Scel	A	T	14: 103,562,518	E202V	probably benign	Het
Slc25a36	G	A	9: 97,080,204	A244V	probably benign	Het
Slc2a13	T	G	15: 91,516,392	Q209P	probably damaging	Het
Slc38a6	A	G	12: 73,352,530	N456S	probably benign	Het
Slc6a12	G	T	6: 121,346,998		probably null	Het
Spag6l	T	C	16: 16,780,629	I333V	probably benign	Het
Spen	G	A	4: 141,474,203	A2371V	probably benign	Het
St6galnac1	T	C	11: 116,766,640	D366G	probably damaging	Het
Stk33	T	C	7: 109,341,489	S5G	probably benign	Het
Tle2	T	C	10: 81,577,648	L84P	probably damaging	Het
Tmem14a	T	C	1: 21,226,652	M78T	probably damaging	Het
Top2b	T	A	14: 16,413,556		probably null	Het
Trmt13	A	G	3: 116,582,650	F364S	probably damaging	Het
Unkl	T	A	17: 25,230,777		probably null	Het
Uvrag	A	G	7: 99,004,719		probably benign	Het
Vmn2r8	T	A	5: 108,802,072	N303I	probably benign	Het
Vsig10l	A	G	7: 43,465,455	N360S	probably damaging	Het
Zdhhc25	T	C	15: 88,600,920	Y153H	probably damaging	Het
Zfp646	T	C	7: 127,883,262	V1537A	possibly damaging	Het
Zfp664	T	A	5: 124,886,065	Y174*	probably null	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TAGAACCCGTCTCAGCCACTATGC -3'
(R):5'- ACCACTCGACTGTGTGCTAGGAAG -3'

Sequencing Primer
(F):5'- ACCATTCTGGGTTCTGACAG -3'
(R):5'- CTAGGAAGCCTGAGGTTACTACC -3'

Posted On

2013-04-24