Incidental Mutation 'R4193:Capn9'
ID318415
Institutional Source Beutler Lab
Gene Symbol Capn9
Ensembl Gene ENSMUSG00000031981
Gene Namecalpain 9
SynonymsGC36, nCL-4
MMRRC Submission 041024-MU
Accession Numbers

Genbank: NM_023709; MGI: 1920897

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4193 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124576111-124618731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124600486 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 292 (S292G)
Ref Sequence ENSEMBL: ENSMUSP00000090717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093033]
Predicted Effect probably null
Transcript: ENSMUST00000093033
AA Change: S292G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090717
Gene: ENSMUSG00000031981
AA Change: S292G

DomainStartEndE-ValueType
CysPc 24 345 1.53e-196 SMART
calpain_III 348 494 1.91e-87 SMART
low complexity region 504 522 N/A INTRINSIC
EFh 565 593 1.25e-2 SMART
EFh 595 623 2.64e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Abcb1a G A 5: 8,715,068 probably null Het
Acap3 A G 4: 155,901,777 T285A probably benign Het
Adam20 A T 8: 40,795,315 N154I probably damaging Het
Adamts8 A T 9: 30,959,308 D693V probably damaging Het
Ak9 A G 10: 41,335,945 H226R probably benign Het
Atp6v1b1 A G 6: 83,743,103 S7G probably benign Het
Atxn7l3b C A 10: 112,928,705 L6F probably damaging Het
Bco1 C T 8: 117,113,469 T242M probably damaging Het
Btla A G 16: 45,250,482 N268S probably benign Het
Col7a1 G A 9: 108,956,672 S403N unknown Het
Ctps A G 4: 120,548,138 V369A probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Dnah7a T C 1: 53,447,334 K3356R probably benign Het
Dpf2 G A 19: 5,907,016 R60* probably null Het
Eif3h A T 15: 51,799,299 V117E probably damaging Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fez1 T A 9: 36,843,727 S7R probably damaging Het
Fh1 T A 1: 175,614,841 M148L possibly damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gfm1 T G 3: 67,431,720 I52S probably damaging Het
Gm13089 A T 4: 143,698,333 L180Q probably damaging Het
Gm281 C T 14: 13,914,416 V9I probably benign Het
Gm6729 A T 10: 86,540,619 noncoding transcript Het
Gpr152 T G 19: 4,142,907 L149R probably damaging Het
Hist3h2ba T A 11: 58,949,241 L101Q probably damaging Het
Ifnar2 A T 16: 91,404,344 D491V probably damaging Het
Igkv14-126 T C 6: 67,896,383 S32P possibly damaging Het
Il1rl2 A G 1: 40,365,048 E443G probably damaging Het
Impg2 A G 16: 56,268,411 D1100G probably benign Het
Itga2 G A 13: 114,886,649 R56* probably null Het
Itga2b A G 11: 102,469,685 S10P probably benign Het
Jmjd1c C T 10: 67,096,681 probably benign Het
Kdm7a T G 6: 39,169,096 K299T probably damaging Het
Large2 T A 2: 92,365,359 D632V probably damaging Het
Lrp2 C T 2: 69,467,143 C3158Y probably damaging Het
Malt1 T A 18: 65,447,675 D213E probably benign Het
Nkapl T C 13: 21,467,342 Q367R probably benign Het
Nwd2 T C 5: 63,807,465 L1464P probably damaging Het
Olfr1016 C T 2: 85,800,018 C84Y probably benign Het
Olfr1037 T A 2: 86,085,700 I26F probably benign Het
Olfr1385 A C 11: 49,495,307 Y258S probably damaging Het
Olfr19 A T 16: 16,673,647 D111E possibly damaging Het
Olfr384 C G 11: 73,603,417 T279R probably damaging Het
P2ry2 A G 7: 100,998,450 V216A probably benign Het
Pcdhb1 A G 18: 37,267,146 K717E probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Phactr3 T A 2: 178,283,152 H293Q probably damaging Het
Pias1 T C 9: 62,952,004 D74G possibly damaging Het
Plekhg6 T C 6: 125,373,118 T286A probably benign Het
Prkag2 A C 5: 24,878,760 M75R probably damaging Het
Prl7c1 T A 13: 27,776,278 M94L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Ptprn2 A G 12: 116,901,008 I548V probably benign Het
Ptprr T C 10: 116,252,864 W307R probably damaging Het
Rab29 T C 1: 131,869,962 S52P possibly damaging Het
Ralgapa2 A G 2: 146,342,573 F1505L probably damaging Het
Scn8a C T 15: 100,971,603 A209V probably damaging Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sept4 A T 11: 87,583,316 probably null Het
Slc17a5 C A 9: 78,559,106 V269L possibly damaging Het
Slc2a9 T C 5: 38,398,706 N299S probably damaging Het
Slc41a2 T A 10: 83,301,221 H274L probably damaging Het
Suco A T 1: 161,863,959 D43E probably benign Het
Tacr2 T A 10: 62,253,179 I121N probably damaging Het
Tanc2 G A 11: 105,914,062 probably benign Het
Tbl1xr1 T C 3: 22,200,358 F322L possibly damaging Het
Tdrd1 T A 19: 56,851,341 L611* probably null Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tmprss12 T C 15: 100,289,304 V217A probably damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r71 A T 7: 10,748,248 I105K possibly damaging Het
Vmn2r57 A G 7: 41,428,239 F168L probably benign Het
Zfp945 C T 17: 22,851,170 probably benign Het
Other mutations in Capn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Capn9 APN 8 124591769 missense probably benign
IGL01987:Capn9 APN 8 124576226 missense probably benign 0.01
IGL02150:Capn9 APN 8 124613843 missense probably benign 0.01
IGL02348:Capn9 APN 8 124594677 missense probably damaging 1.00
IGL02720:Capn9 APN 8 124600497 splice site probably benign
IGL02723:Capn9 APN 8 124609183 splice site probably benign
IGL03065:Capn9 APN 8 124605559 missense probably damaging 1.00
IGL03169:Capn9 APN 8 124605877 missense probably damaging 1.00
A2778:Capn9 UTSW 8 124605478 missense possibly damaging 0.95
R0288:Capn9 UTSW 8 124600491 splice site probably benign
R1353:Capn9 UTSW 8 124605566 splice site probably null
R1611:Capn9 UTSW 8 124611512 missense possibly damaging 0.90
R1672:Capn9 UTSW 8 124613831 missense probably benign 0.03
R1682:Capn9 UTSW 8 124611565 splice site probably null
R1729:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1739:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1762:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1783:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1784:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1785:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1836:Capn9 UTSW 8 124605565 critical splice donor site probably null
R1883:Capn9 UTSW 8 124611558 missense probably benign
R1924:Capn9 UTSW 8 124576226 missense probably benign 0.01
R2008:Capn9 UTSW 8 124591685 missense probably damaging 1.00
R2049:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2069:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2131:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2141:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2219:Capn9 UTSW 8 124609159 nonsense probably null
R4707:Capn9 UTSW 8 124613456 missense possibly damaging 0.82
R5092:Capn9 UTSW 8 124597525 missense probably damaging 1.00
R5386:Capn9 UTSW 8 124605540 missense possibly damaging 0.83
R5697:Capn9 UTSW 8 124589071 missense unknown
R5734:Capn9 UTSW 8 124605844 missense probably damaging 1.00
R5999:Capn9 UTSW 8 124589078 missense probably damaging 1.00
R6026:Capn9 UTSW 8 124605862 missense probably damaging 1.00
R6298:Capn9 UTSW 8 124617454 missense probably benign
R6787:Capn9 UTSW 8 124616185 missense probably benign 0.00
R6856:Capn9 UTSW 8 124597569 missense probably damaging 1.00
R7131:Capn9 UTSW 8 124576278 missense probably damaging 1.00
R7149:Capn9 UTSW 8 124605709 missense probably benign 0.00
RF015:Capn9 UTSW 8 124618482 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTGGTTTCCTCAAGAGCCTG -3'
(R):5'- CCATCCCAGGGAAAGAGTTG -3'

Sequencing Primer
(F):5'- GTTTCCTCAAGAGCCTGGGTAAC -3'
(R):5'- CATCCCAGGGAAAGAGTTGTTTATAG -3'
Posted On2015-06-10