Incidental Mutation 'R4193:Slc41a2'
ID318425
Institutional Source Beutler Lab
Gene Symbol Slc41a2
Ensembl Gene ENSMUSG00000034591
Gene Namesolute carrier family 41, member 2
SynonymsA230035L05Rik
MMRRC Submission 041024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4193 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location83230848-83337882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83301221 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 274 (H274L)
Ref Sequence ENSEMBL: ENSMUSP00000036690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039956]
Predicted Effect probably damaging
Transcript: ENSMUST00000039956
AA Change: H274L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591
AA Change: H274L

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139329
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Abcb1a G A 5: 8,715,068 probably null Het
Acap3 A G 4: 155,901,777 T285A probably benign Het
Adam20 A T 8: 40,795,315 N154I probably damaging Het
Adamts8 A T 9: 30,959,308 D693V probably damaging Het
Ak9 A G 10: 41,335,945 H226R probably benign Het
Atp6v1b1 A G 6: 83,743,103 S7G probably benign Het
Atxn7l3b C A 10: 112,928,705 L6F probably damaging Het
Bco1 C T 8: 117,113,469 T242M probably damaging Het
Btla A G 16: 45,250,482 N268S probably benign Het
Capn9 A G 8: 124,600,486 S292G probably null Het
Col7a1 G A 9: 108,956,672 S403N unknown Het
Ctps A G 4: 120,548,138 V369A probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Dnah7a T C 1: 53,447,334 K3356R probably benign Het
Dpf2 G A 19: 5,907,016 R60* probably null Het
Eif3h A T 15: 51,799,299 V117E probably damaging Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fez1 T A 9: 36,843,727 S7R probably damaging Het
Fh1 T A 1: 175,614,841 M148L possibly damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gfm1 T G 3: 67,431,720 I52S probably damaging Het
Gm13089 A T 4: 143,698,333 L180Q probably damaging Het
Gm281 C T 14: 13,914,416 V9I probably benign Het
Gm6729 A T 10: 86,540,619 noncoding transcript Het
Gpr152 T G 19: 4,142,907 L149R probably damaging Het
Hist3h2ba T A 11: 58,949,241 L101Q probably damaging Het
Ifnar2 A T 16: 91,404,344 D491V probably damaging Het
Igkv14-126 T C 6: 67,896,383 S32P possibly damaging Het
Il1rl2 A G 1: 40,365,048 E443G probably damaging Het
Impg2 A G 16: 56,268,411 D1100G probably benign Het
Itga2 G A 13: 114,886,649 R56* probably null Het
Itga2b A G 11: 102,469,685 S10P probably benign Het
Jmjd1c C T 10: 67,096,681 probably benign Het
Kdm7a T G 6: 39,169,096 K299T probably damaging Het
Large2 T A 2: 92,365,359 D632V probably damaging Het
Lrp2 C T 2: 69,467,143 C3158Y probably damaging Het
Malt1 T A 18: 65,447,675 D213E probably benign Het
Nkapl T C 13: 21,467,342 Q367R probably benign Het
Nwd2 T C 5: 63,807,465 L1464P probably damaging Het
Olfr1016 C T 2: 85,800,018 C84Y probably benign Het
Olfr1037 T A 2: 86,085,700 I26F probably benign Het
Olfr1385 A C 11: 49,495,307 Y258S probably damaging Het
Olfr19 A T 16: 16,673,647 D111E possibly damaging Het
Olfr384 C G 11: 73,603,417 T279R probably damaging Het
P2ry2 A G 7: 100,998,450 V216A probably benign Het
Pcdhb1 A G 18: 37,267,146 K717E probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Phactr3 T A 2: 178,283,152 H293Q probably damaging Het
Pias1 T C 9: 62,952,004 D74G possibly damaging Het
Plekhg6 T C 6: 125,373,118 T286A probably benign Het
Prkag2 A C 5: 24,878,760 M75R probably damaging Het
Prl7c1 T A 13: 27,776,278 M94L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Ptprn2 A G 12: 116,901,008 I548V probably benign Het
Ptprr T C 10: 116,252,864 W307R probably damaging Het
Rab29 T C 1: 131,869,962 S52P possibly damaging Het
Ralgapa2 A G 2: 146,342,573 F1505L probably damaging Het
Scn8a C T 15: 100,971,603 A209V probably damaging Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sept4 A T 11: 87,583,316 probably null Het
Slc17a5 C A 9: 78,559,106 V269L possibly damaging Het
Slc2a9 T C 5: 38,398,706 N299S probably damaging Het
Suco A T 1: 161,863,959 D43E probably benign Het
Tacr2 T A 10: 62,253,179 I121N probably damaging Het
Tanc2 G A 11: 105,914,062 probably benign Het
Tbl1xr1 T C 3: 22,200,358 F322L possibly damaging Het
Tdrd1 T A 19: 56,851,341 L611* probably null Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tmprss12 T C 15: 100,289,304 V217A probably damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r71 A T 7: 10,748,248 I105K possibly damaging Het
Vmn2r57 A G 7: 41,428,239 F168L probably benign Het
Zfp945 C T 17: 22,851,170 probably benign Het
Other mutations in Slc41a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Slc41a2 APN 10 83313530 unclassified probably benign
IGL02263:Slc41a2 APN 10 83313500 missense possibly damaging 0.82
IGL02338:Slc41a2 APN 10 83316591 missense possibly damaging 0.68
IGL02680:Slc41a2 APN 10 83283864 missense probably benign 0.20
IGL02703:Slc41a2 APN 10 83254847 missense probably damaging 1.00
IGL03039:Slc41a2 APN 10 83283858 missense probably benign 0.37
PIT4508001:Slc41a2 UTSW 10 83254880 missense probably damaging 0.99
R0326:Slc41a2 UTSW 10 83283746 missense probably damaging 1.00
R0470:Slc41a2 UTSW 10 83316222 missense possibly damaging 0.94
R0610:Slc41a2 UTSW 10 83283728 missense possibly damaging 0.75
R1708:Slc41a2 UTSW 10 83233732 missense probably damaging 1.00
R1765:Slc41a2 UTSW 10 83301266 missense probably damaging 1.00
R1870:Slc41a2 UTSW 10 83301165 nonsense probably null
R1875:Slc41a2 UTSW 10 83256085 missense probably damaging 1.00
R2008:Slc41a2 UTSW 10 83304303 critical splice donor site probably null
R2172:Slc41a2 UTSW 10 83283774 missense probably benign 0.00
R4789:Slc41a2 UTSW 10 83316456 missense probably damaging 1.00
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4913:Slc41a2 UTSW 10 83313420 missense probably damaging 1.00
R5012:Slc41a2 UTSW 10 83301263 missense probably benign 0.02
R5140:Slc41a2 UTSW 10 83297291 missense probably damaging 0.98
R5189:Slc41a2 UTSW 10 83313411 splice site probably null
R5410:Slc41a2 UTSW 10 83281368 critical splice donor site probably null
R5748:Slc41a2 UTSW 10 83297159 missense probably benign 0.00
R5808:Slc41a2 UTSW 10 83313498 missense probably benign 0.29
R6124:Slc41a2 UTSW 10 83297252 missense probably damaging 1.00
R6292:Slc41a2 UTSW 10 83254926 missense probably damaging 0.99
R6511:Slc41a2 UTSW 10 83283788 missense probably damaging 0.99
R6793:Slc41a2 UTSW 10 83301158 splice site probably null
R6970:Slc41a2 UTSW 10 83316096 missense possibly damaging 0.53
R7584:Slc41a2 UTSW 10 83316789 splice site probably benign
R7752:Slc41a2 UTSW 10 83256041 missense possibly damaging 0.73
R8289:Slc41a2 UTSW 10 83301180 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAAGCCTGTCCTCCACTGTG -3'
(R):5'- CCCAGCACCCTAATGATCTTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGTACTCAGGAGGCAG -3'
(R):5'- GCACCCTAATGATCTTGTATGTAATG -3'
Posted On2015-06-10