Incidental Mutation 'R4193:Olfr384'
ID318431
Institutional Source Beutler Lab
Gene Symbol Olfr384
Ensembl Gene ENSMUSG00000060335
Gene Nameolfactory receptor 384
SynonymsOlfr386, GA_x6K02T2P1NL-3739520-3740032, GA_x6K02T2P1NL-3773152-3774090, MOR135-5
MMRRC Submission 041024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4193 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73598594-73605092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 73603417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 279 (T279R)
Ref Sequence ENSEMBL: ENSMUSP00000148997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072993] [ENSMUST00000214228]
Predicted Effect probably damaging
Transcript: ENSMUST00000072993
AA Change: T279R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072758
Gene: ENSMUSG00000060335
AA Change: T279R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.6e-9 PFAM
Pfam:7tm_1 41 290 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214228
AA Change: T279R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Abcb1a G A 5: 8,715,068 probably null Het
Acap3 A G 4: 155,901,777 T285A probably benign Het
Adam20 A T 8: 40,795,315 N154I probably damaging Het
Adamts8 A T 9: 30,959,308 D693V probably damaging Het
Ak9 A G 10: 41,335,945 H226R probably benign Het
Atp6v1b1 A G 6: 83,743,103 S7G probably benign Het
Atxn7l3b C A 10: 112,928,705 L6F probably damaging Het
Bco1 C T 8: 117,113,469 T242M probably damaging Het
Btla A G 16: 45,250,482 N268S probably benign Het
Capn9 A G 8: 124,600,486 S292G probably null Het
Col7a1 G A 9: 108,956,672 S403N unknown Het
Ctps A G 4: 120,548,138 V369A probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Dnah7a T C 1: 53,447,334 K3356R probably benign Het
Dpf2 G A 19: 5,907,016 R60* probably null Het
Eif3h A T 15: 51,799,299 V117E probably damaging Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fez1 T A 9: 36,843,727 S7R probably damaging Het
Fh1 T A 1: 175,614,841 M148L possibly damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gfm1 T G 3: 67,431,720 I52S probably damaging Het
Gm13089 A T 4: 143,698,333 L180Q probably damaging Het
Gm281 C T 14: 13,914,416 V9I probably benign Het
Gm6729 A T 10: 86,540,619 noncoding transcript Het
Gpr152 T G 19: 4,142,907 L149R probably damaging Het
Hist3h2ba T A 11: 58,949,241 L101Q probably damaging Het
Ifnar2 A T 16: 91,404,344 D491V probably damaging Het
Igkv14-126 T C 6: 67,896,383 S32P possibly damaging Het
Il1rl2 A G 1: 40,365,048 E443G probably damaging Het
Impg2 A G 16: 56,268,411 D1100G probably benign Het
Itga2 G A 13: 114,886,649 R56* probably null Het
Itga2b A G 11: 102,469,685 S10P probably benign Het
Jmjd1c C T 10: 67,096,681 probably benign Het
Kdm7a T G 6: 39,169,096 K299T probably damaging Het
Large2 T A 2: 92,365,359 D632V probably damaging Het
Lrp2 C T 2: 69,467,143 C3158Y probably damaging Het
Malt1 T A 18: 65,447,675 D213E probably benign Het
Nkapl T C 13: 21,467,342 Q367R probably benign Het
Nwd2 T C 5: 63,807,465 L1464P probably damaging Het
Olfr1016 C T 2: 85,800,018 C84Y probably benign Het
Olfr1037 T A 2: 86,085,700 I26F probably benign Het
Olfr1385 A C 11: 49,495,307 Y258S probably damaging Het
Olfr19 A T 16: 16,673,647 D111E possibly damaging Het
P2ry2 A G 7: 100,998,450 V216A probably benign Het
Pcdhb1 A G 18: 37,267,146 K717E probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Phactr3 T A 2: 178,283,152 H293Q probably damaging Het
Pias1 T C 9: 62,952,004 D74G possibly damaging Het
Plekhg6 T C 6: 125,373,118 T286A probably benign Het
Prkag2 A C 5: 24,878,760 M75R probably damaging Het
Prl7c1 T A 13: 27,776,278 M94L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Ptprn2 A G 12: 116,901,008 I548V probably benign Het
Ptprr T C 10: 116,252,864 W307R probably damaging Het
Rab29 T C 1: 131,869,962 S52P possibly damaging Het
Ralgapa2 A G 2: 146,342,573 F1505L probably damaging Het
Scn8a C T 15: 100,971,603 A209V probably damaging Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sept4 A T 11: 87,583,316 probably null Het
Slc17a5 C A 9: 78,559,106 V269L possibly damaging Het
Slc2a9 T C 5: 38,398,706 N299S probably damaging Het
Slc41a2 T A 10: 83,301,221 H274L probably damaging Het
Suco A T 1: 161,863,959 D43E probably benign Het
Tacr2 T A 10: 62,253,179 I121N probably damaging Het
Tanc2 G A 11: 105,914,062 probably benign Het
Tbl1xr1 T C 3: 22,200,358 F322L possibly damaging Het
Tdrd1 T A 19: 56,851,341 L611* probably null Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tmprss12 T C 15: 100,289,304 V217A probably damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r71 A T 7: 10,748,248 I105K possibly damaging Het
Vmn2r57 A G 7: 41,428,239 F168L probably benign Het
Zfp945 C T 17: 22,851,170 probably benign Het
Other mutations in Olfr384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr384 APN 11 73603230 missense probably damaging 1.00
IGL01767:Olfr384 APN 11 73603032 missense probably benign
IGL02296:Olfr384 APN 11 73602706 missense probably damaging 1.00
IGL02327:Olfr384 APN 11 73603155 missense probably damaging 1.00
IGL02740:Olfr384 APN 11 73602831 missense probably benign 0.41
H8562:Olfr384 UTSW 11 73603447 missense probably damaging 1.00
R0594:Olfr384 UTSW 11 73603392 missense probably benign 0.03
R2038:Olfr384 UTSW 11 73603413 missense probably damaging 1.00
R2127:Olfr384 UTSW 11 73602805 missense possibly damaging 0.78
R2844:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R2846:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R3877:Olfr384 UTSW 11 73603153 missense probably damaging 1.00
R4433:Olfr384 UTSW 11 73602886 missense probably damaging 1.00
R4824:Olfr384 UTSW 11 73602600 missense possibly damaging 0.61
R4851:Olfr384 UTSW 11 73603057 missense probably damaging 1.00
R5285:Olfr384 UTSW 11 73602941 nonsense probably null
R5326:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5542:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5662:Olfr384 UTSW 11 73603179 missense probably benign 0.03
R6489:Olfr384 UTSW 11 73603439 missense probably damaging 1.00
R6770:Olfr384 UTSW 11 73602978 missense probably benign 0.04
R7131:Olfr384 UTSW 11 73602736 missense possibly damaging 0.78
R7313:Olfr384 UTSW 11 73602984 missense probably damaging 0.99
R7754:Olfr384 UTSW 11 73603506 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATACTGTGGTGCCATTCTTACTC -3'
(R):5'- ACTCAGTGTATCTTATTGCAGGG -3'

Sequencing Primer
(F):5'- ATGTACAAATTGTCTGCTCCATTC -3'
(R):5'- TGTATCTTATTGCAGGGATACATTTG -3'
Posted On2015-06-10