Incidental Mutation 'R4193:Vit'
ID 318456
Institutional Source Beutler Lab
Gene Symbol Vit
Ensembl Gene ENSMUSG00000024076
Gene Name vitrin
Synonyms
MMRRC Submission 041024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4193 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 78508063-78627409 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78586826 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 219 (H219R)
Ref Sequence ENSEMBL: ENSMUSP00000024880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024880]
AlphaFold Q8VHI5
Predicted Effect probably benign
Transcript: ENSMUST00000024880
AA Change: H219R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: H219R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 42 124 2.5e-45 SMART
low complexity region 148 171 N/A INTRINSIC
VWA 263 451 7.34e-39 SMART
VWA 465 641 1.02e-46 SMART
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Abcb1a G A 5: 8,715,068 probably null Het
Acap3 A G 4: 155,901,777 T285A probably benign Het
Adam20 A T 8: 40,795,315 N154I probably damaging Het
Adamts8 A T 9: 30,959,308 D693V probably damaging Het
Ak9 A G 10: 41,335,945 H226R probably benign Het
Atp6v1b1 A G 6: 83,743,103 S7G probably benign Het
Atxn7l3b C A 10: 112,928,705 L6F probably damaging Het
Bco1 C T 8: 117,113,469 T242M probably damaging Het
Btla A G 16: 45,250,482 N268S probably benign Het
Capn9 A G 8: 124,600,486 S292G probably null Het
Col7a1 G A 9: 108,956,672 S403N unknown Het
Ctps A G 4: 120,548,138 V369A probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Dnah7a T C 1: 53,447,334 K3356R probably benign Het
Dpf2 G A 19: 5,907,016 R60* probably null Het
Eif3h A T 15: 51,799,299 V117E probably damaging Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fez1 T A 9: 36,843,727 S7R probably damaging Het
Fh1 T A 1: 175,614,841 M148L possibly damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gfm1 T G 3: 67,431,720 I52S probably damaging Het
Gm13089 A T 4: 143,698,333 L180Q probably damaging Het
Gm281 C T 14: 13,914,416 V9I probably benign Het
Gm6729 A T 10: 86,540,619 noncoding transcript Het
Gpr152 T G 19: 4,142,907 L149R probably damaging Het
Hist3h2ba T A 11: 58,949,241 L101Q probably damaging Het
Ifnar2 A T 16: 91,404,344 D491V probably damaging Het
Igkv14-126 T C 6: 67,896,383 S32P possibly damaging Het
Il1rl2 A G 1: 40,365,048 E443G probably damaging Het
Impg2 A G 16: 56,268,411 D1100G probably benign Het
Itga2 G A 13: 114,886,649 R56* probably null Het
Itga2b A G 11: 102,469,685 S10P probably benign Het
Jmjd1c C T 10: 67,096,681 probably benign Het
Kdm7a T G 6: 39,169,096 K299T probably damaging Het
Large2 T A 2: 92,365,359 D632V probably damaging Het
Lrp2 C T 2: 69,467,143 C3158Y probably damaging Het
Malt1 T A 18: 65,447,675 D213E probably benign Het
Nkapl T C 13: 21,467,342 Q367R probably benign Het
Nwd2 T C 5: 63,807,465 L1464P probably damaging Het
Olfr1016 C T 2: 85,800,018 C84Y probably benign Het
Olfr1037 T A 2: 86,085,700 I26F probably benign Het
Olfr1385 A C 11: 49,495,307 Y258S probably damaging Het
Olfr19 A T 16: 16,673,647 D111E possibly damaging Het
Olfr384 C G 11: 73,603,417 T279R probably damaging Het
P2ry2 A G 7: 100,998,450 V216A probably benign Het
Pcdhb1 A G 18: 37,267,146 K717E probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Phactr3 T A 2: 178,283,152 H293Q probably damaging Het
Pias1 T C 9: 62,952,004 D74G possibly damaging Het
Plekhg6 T C 6: 125,373,118 T286A probably benign Het
Prkag2 A C 5: 24,878,760 M75R probably damaging Het
Prl7c1 T A 13: 27,776,278 M94L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Ptprn2 A G 12: 116,901,008 I548V probably benign Het
Ptprr T C 10: 116,252,864 W307R probably damaging Het
Rab29 T C 1: 131,869,962 S52P possibly damaging Het
Ralgapa2 A G 2: 146,342,573 F1505L probably damaging Het
Scn8a C T 15: 100,971,603 A209V probably damaging Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sept4 A T 11: 87,583,316 probably null Het
Slc17a5 C A 9: 78,559,106 V269L possibly damaging Het
Slc2a9 T C 5: 38,398,706 N299S probably damaging Het
Slc41a2 T A 10: 83,301,221 H274L probably damaging Het
Suco A T 1: 161,863,959 D43E probably benign Het
Tacr2 T A 10: 62,253,179 I121N probably damaging Het
Tanc2 G A 11: 105,914,062 probably benign Het
Tbl1xr1 T C 3: 22,200,358 F322L possibly damaging Het
Tdrd1 T A 19: 56,851,341 L611* probably null Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tmprss12 T C 15: 100,289,304 V217A probably damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vmn1r71 A T 7: 10,748,248 I105K possibly damaging Het
Vmn2r57 A G 7: 41,428,239 F168L probably benign Het
Zfp945 C T 17: 22,851,170 probably benign Het
Other mutations in Vit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vit APN 17 78601907 critical splice donor site probably null
IGL00929:Vit APN 17 78579401 missense probably damaging 0.98
IGL01447:Vit APN 17 78625204 missense probably damaging 1.00
IGL02000:Vit APN 17 78605486 missense possibly damaging 0.94
IGL02230:Vit APN 17 78619627 missense probably damaging 1.00
IGL02245:Vit APN 17 78625051 missense probably damaging 1.00
IGL02315:Vit APN 17 78622658 missense possibly damaging 0.80
IGL03133:Vit APN 17 78566071 missense probably benign
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0520:Vit UTSW 17 78625159 missense probably damaging 1.00
R0550:Vit UTSW 17 78624793 missense possibly damaging 0.95
R0565:Vit UTSW 17 78624837 missense probably damaging 1.00
R0856:Vit UTSW 17 78619657 missense possibly damaging 0.53
R1155:Vit UTSW 17 78566027 missense probably damaging 1.00
R1327:Vit UTSW 17 78625200 missense probably damaging 1.00
R1690:Vit UTSW 17 78624865 missense probably damaging 1.00
R1802:Vit UTSW 17 78605511 missense possibly damaging 0.91
R1822:Vit UTSW 17 78622836 missense probably benign 0.01
R1826:Vit UTSW 17 78534676 missense probably benign 0.22
R1827:Vit UTSW 17 78546446 critical splice donor site probably null
R1862:Vit UTSW 17 78622746 missense probably damaging 1.00
R2235:Vit UTSW 17 78605438 missense probably benign 0.01
R2571:Vit UTSW 17 78586745 missense probably benign
R4011:Vit UTSW 17 78534692 splice site probably benign
R4190:Vit UTSW 17 78586826 missense probably benign 0.13
R4191:Vit UTSW 17 78586826 missense probably benign 0.13
R4192:Vit UTSW 17 78586826 missense probably benign 0.13
R4635:Vit UTSW 17 78574212 missense probably benign 0.01
R4705:Vit UTSW 17 78625114 missense probably damaging 1.00
R4841:Vit UTSW 17 78601879 missense probably benign
R4842:Vit UTSW 17 78601879 missense probably benign
R4884:Vit UTSW 17 78624753 missense probably damaging 0.99
R4923:Vit UTSW 17 78586841 missense probably benign 0.03
R5128:Vit UTSW 17 78625146 missense probably damaging 1.00
R5272:Vit UTSW 17 78586835 missense probably benign
R5779:Vit UTSW 17 78546426 missense probably benign
R6596:Vit UTSW 17 78622845 missense probably benign 0.35
R6658:Vit UTSW 17 78622803 missense possibly damaging 0.93
R6792:Vit UTSW 17 78579399 missense probably damaging 1.00
R6894:Vit UTSW 17 78626758 nonsense probably null
R7032:Vit UTSW 17 78624865 missense probably damaging 1.00
R7061:Vit UTSW 17 78625156 missense probably damaging 1.00
R7102:Vit UTSW 17 78624997 missense probably damaging 1.00
R7106:Vit UTSW 17 78586799 missense probably benign
R7292:Vit UTSW 17 78605498 missense probably benign 0.03
R7413:Vit UTSW 17 78624880 missense probably damaging 1.00
R8191:Vit UTSW 17 78546399 missense probably benign 0.00
R8385:Vit UTSW 17 78619637 missense probably benign 0.01
R9106:Vit UTSW 17 78626849 missense probably damaging 1.00
R9314:Vit UTSW 17 78619615 missense probably benign 0.02
R9433:Vit UTSW 17 78624984 missense probably damaging 1.00
R9588:Vit UTSW 17 78622650 missense probably damaging 0.98
R9772:Vit UTSW 17 78624969 missense probably damaging 1.00
X0023:Vit UTSW 17 78566164 missense probably benign
X0064:Vit UTSW 17 78624885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAAAAGACAGTGGTGGTC -3'
(R):5'- TCCCACCTGGTGAAAGTCTC -3'

Sequencing Primer
(F):5'- GCAACTCTGCTTTCTCACAGGTG -3'
(R):5'- GTCTCACACACCCCTGAGTC -3'
Posted On 2015-06-10