Incidental Mutation 'R4193:Pcdhgb8'
ID318458
Institutional Source Beutler Lab
Gene Symbol Pcdhgb8
Ensembl Gene ENSMUSG00000103081
Gene Nameprotocadherin gamma subfamily B, 8
Synonyms
MMRRC Submission 041024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4193 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37761801-37841870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 37763541 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 555 (D555H)
Ref Sequence ENSEMBL: ENSMUSP00000146671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003599] [ENSMUST00000044851] [ENSMUST00000061279] [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000091935] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000195764] [ENSMUST00000208907] [ENSMUST00000193404] [ENSMUST00000195823] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000195112] [ENSMUST00000194928] [ENSMUST00000194544] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000195363]
Predicted Effect probably benign
Transcript: ENSMUST00000003599
SMART Domains Protein: ENSMUSP00000003599
Gene: ENSMUSG00000103088

DomainStartEndE-ValueType
CA 47 131 8.06e-6 SMART
CA 155 240 2.29e-19 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 4.94e-24 SMART
CA 474 560 7.6e-25 SMART
CA 591 672 9.18e-10 SMART
Pfam:Cadherin_C_2 687 768 3.5e-20 PFAM
Pfam:Cadherin_tail 807 930 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044851
SMART Domains Protein: ENSMUSP00000036359
Gene: ENSMUSG00000102428

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
CA 45 131 3.28e-1 SMART
CA 155 240 1.8e-17 SMART
CA 264 345 9.22e-24 SMART
CA 369 450 1.28e-22 SMART
CA 474 560 1.09e-25 SMART
CA 591 669 9.24e-15 SMART
Pfam:Cadherin_C_2 688 772 3.6e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061279
SMART Domains Protein: ENSMUSP00000058362
Gene: ENSMUSG00000102742

DomainStartEndE-ValueType
CA 45 131 3.23e-2 SMART
CA 155 240 2.22e-17 SMART
CA 264 345 3.36e-26 SMART
CA 369 450 7.09e-25 SMART
CA 474 560 3.55e-25 SMART
CA 591 669 2.53e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 914 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066149
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091935
SMART Domains Protein: ENSMUSP00000089555
Gene: ENSMUSG00000102440

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 32 132 8.37e-3 SMART
CA 156 241 5.51e-22 SMART
CA 265 346 8.27e-26 SMART
CA 370 451 1.4e-23 SMART
CA 475 561 2.97e-27 SMART
CA 592 670 1.18e-12 SMART
Pfam:Cadherin_C_2 688 772 3.9e-24 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192501
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193045
Predicted Effect probably damaging
Transcript: ENSMUST00000195764
AA Change: D555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142272
Gene: ENSMUSG00000103081
AA Change: D555H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 57 132 1.5e-4 SMART
CA 156 241 1.2e-20 SMART
CA 265 346 7.8e-29 SMART
CA 370 451 1.7e-26 SMART
CA 475 561 2.2e-26 SMART
CA 592 673 6.4e-12 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208907
AA Change: D555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000193404
SMART Domains Protein: ENSMUSP00000141359
Gene: ENSMUSG00000102222

DomainStartEndE-ValueType
CA 43 129 2.76e-2 SMART
CA 153 238 1.16e-20 SMART
CA 262 343 1.25e-25 SMART
CA 367 448 4.75e-26 SMART
CA 472 558 3.69e-23 SMART
CA 589 667 3.84e-12 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194928
SMART Domains Protein: ENSMUSP00000141997
Gene: ENSMUSG00000104063

DomainStartEndE-ValueType
CA 47 131 2.48e-6 SMART
CA 155 240 1.57e-17 SMART
CA 264 343 1.29e-27 SMART
CA 367 448 9.14e-28 SMART
CA 472 558 1.24e-24 SMART
CA 589 670 3.73e-10 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 716 721 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Abcb1a G A 5: 8,715,068 probably null Het
Acap3 A G 4: 155,901,777 T285A probably benign Het
Adam20 A T 8: 40,795,315 N154I probably damaging Het
Adamts8 A T 9: 30,959,308 D693V probably damaging Het
Ak9 A G 10: 41,335,945 H226R probably benign Het
Atp6v1b1 A G 6: 83,743,103 S7G probably benign Het
Atxn7l3b C A 10: 112,928,705 L6F probably damaging Het
Bco1 C T 8: 117,113,469 T242M probably damaging Het
Btla A G 16: 45,250,482 N268S probably benign Het
Capn9 A G 8: 124,600,486 S292G probably null Het
Col7a1 G A 9: 108,956,672 S403N unknown Het
Ctps A G 4: 120,548,138 V369A probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Dnah7a T C 1: 53,447,334 K3356R probably benign Het
Dpf2 G A 19: 5,907,016 R60* probably null Het
Eif3h A T 15: 51,799,299 V117E probably damaging Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fez1 T A 9: 36,843,727 S7R probably damaging Het
Fh1 T A 1: 175,614,841 M148L possibly damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gfm1 T G 3: 67,431,720 I52S probably damaging Het
Gm13089 A T 4: 143,698,333 L180Q probably damaging Het
Gm281 C T 14: 13,914,416 V9I probably benign Het
Gm6729 A T 10: 86,540,619 noncoding transcript Het
Gpr152 T G 19: 4,142,907 L149R probably damaging Het
Hist3h2ba T A 11: 58,949,241 L101Q probably damaging Het
Ifnar2 A T 16: 91,404,344 D491V probably damaging Het
Igkv14-126 T C 6: 67,896,383 S32P possibly damaging Het
Il1rl2 A G 1: 40,365,048 E443G probably damaging Het
Impg2 A G 16: 56,268,411 D1100G probably benign Het
Itga2 G A 13: 114,886,649 R56* probably null Het
Itga2b A G 11: 102,469,685 S10P probably benign Het
Jmjd1c C T 10: 67,096,681 probably benign Het
Kdm7a T G 6: 39,169,096 K299T probably damaging Het
Large2 T A 2: 92,365,359 D632V probably damaging Het
Lrp2 C T 2: 69,467,143 C3158Y probably damaging Het
Malt1 T A 18: 65,447,675 D213E probably benign Het
Nkapl T C 13: 21,467,342 Q367R probably benign Het
Nwd2 T C 5: 63,807,465 L1464P probably damaging Het
Olfr1016 C T 2: 85,800,018 C84Y probably benign Het
Olfr1037 T A 2: 86,085,700 I26F probably benign Het
Olfr1385 A C 11: 49,495,307 Y258S probably damaging Het
Olfr19 A T 16: 16,673,647 D111E possibly damaging Het
Olfr384 C G 11: 73,603,417 T279R probably damaging Het
P2ry2 A G 7: 100,998,450 V216A probably benign Het
Pcdhb1 A G 18: 37,267,146 K717E probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Phactr3 T A 2: 178,283,152 H293Q probably damaging Het
Pias1 T C 9: 62,952,004 D74G possibly damaging Het
Plekhg6 T C 6: 125,373,118 T286A probably benign Het
Prkag2 A C 5: 24,878,760 M75R probably damaging Het
Prl7c1 T A 13: 27,776,278 M94L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Ptprn2 A G 12: 116,901,008 I548V probably benign Het
Ptprr T C 10: 116,252,864 W307R probably damaging Het
Rab29 T C 1: 131,869,962 S52P possibly damaging Het
Ralgapa2 A G 2: 146,342,573 F1505L probably damaging Het
Scn8a C T 15: 100,971,603 A209V probably damaging Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sept4 A T 11: 87,583,316 probably null Het
Slc17a5 C A 9: 78,559,106 V269L possibly damaging Het
Slc2a9 T C 5: 38,398,706 N299S probably damaging Het
Slc41a2 T A 10: 83,301,221 H274L probably damaging Het
Suco A T 1: 161,863,959 D43E probably benign Het
Tacr2 T A 10: 62,253,179 I121N probably damaging Het
Tanc2 G A 11: 105,914,062 probably benign Het
Tbl1xr1 T C 3: 22,200,358 F322L possibly damaging Het
Tdrd1 T A 19: 56,851,341 L611* probably null Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tmprss12 T C 15: 100,289,304 V217A probably damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r71 A T 7: 10,748,248 I105K possibly damaging Het
Vmn2r57 A G 7: 41,428,239 F168L probably benign Het
Zfp945 C T 17: 22,851,170 probably benign Het
Other mutations in Pcdhgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Pcdhgb8 APN 18 37825036 missense probably damaging 1.00
R0011:Pcdhgb8 UTSW 18 37764282 missense probably benign 0.03
R2763:Pcdhgb8 UTSW 18 37762262 missense probably damaging 1.00
R3797:Pcdhgb8 UTSW 18 37762675 missense probably benign 0.00
R3926:Pcdhgb8 UTSW 18 37762390 missense probably damaging 1.00
R4012:Pcdhgb8 UTSW 18 37763361 missense probably benign 0.32
R4167:Pcdhgb8 UTSW 18 37762543 missense possibly damaging 0.82
R4183:Pcdhgb8 UTSW 18 37763541 missense probably damaging 1.00
R4190:Pcdhgb8 UTSW 18 37763541 missense probably damaging 1.00
R4191:Pcdhgb8 UTSW 18 37763541 missense probably damaging 1.00
R4192:Pcdhgb8 UTSW 18 37763541 missense probably damaging 1.00
R4441:Pcdhgb8 UTSW 18 37763061 missense possibly damaging 0.84
R4585:Pcdhgb8 UTSW 18 37762360 missense probably benign 0.24
R4762:Pcdhgb8 UTSW 18 37762366 missense probably damaging 1.00
R4917:Pcdhgb8 UTSW 18 37764138 missense probably damaging 1.00
R5825:Pcdhgb8 UTSW 18 37762236 missense probably benign 0.03
R5992:Pcdhgb8 UTSW 18 37763449 missense probably damaging 1.00
R6034:Pcdhgb8 UTSW 18 37762548 missense possibly damaging 0.54
R6034:Pcdhgb8 UTSW 18 37762548 missense possibly damaging 0.54
R6346:Pcdhgb8 UTSW 18 37762078 missense probably damaging 1.00
R6800:Pcdhgb8 UTSW 18 37763527 missense probably benign 0.40
R6833:Pcdhgb8 UTSW 18 37762089 missense probably benign 0.14
R6834:Pcdhgb8 UTSW 18 37762089 missense probably benign 0.14
R7032:Pcdhgb8 UTSW 18 37763909 missense probably benign 0.00
R7035:Pcdhgb8 UTSW 18 37763148 missense possibly damaging 0.93
R7145:Pcdhgb8 UTSW 18 37762997 nonsense probably null
R7165:Pcdhgb8 UTSW 18 37763178 missense possibly damaging 0.82
R7240:Pcdhgb8 UTSW 18 37763703 missense probably damaging 0.99
R7314:Pcdhgb8 UTSW 18 37762999 missense probably damaging 1.00
R7463:Pcdhgb8 UTSW 18 37763427 missense probably damaging 1.00
R7922:Pcdhgb8 UTSW 18 37763949 missense probably benign 0.00
R8052:Pcdhgb8 UTSW 18 37763502 missense probably benign 0.00
R8477:Pcdhgb8 UTSW 18 37763312 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCATTGCTCAGGTCAGC -3'
(R):5'- GCAGCACGTGGTAAGATAGC -3'

Sequencing Primer
(F):5'- GGGATCCAATGGTTTCATCTCC -3'
(R):5'- TAAGATAGCCAGGCATTGTGTCC -3'
Posted On2015-06-10