Incidental Mutation 'R4194:Kifap3'
ID318464
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission 041025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4194 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163915825 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 792 (S792P)
Ref Sequence ENSEMBL: ENSMUSP00000027877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect probably benign
Transcript: ENSMUST00000027877
AA Change: S792P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: S792P

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077642
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,071 V226E probably damaging Het
Adamtsl1 A T 4: 86,054,008 probably benign Het
Adgrv1 C A 13: 81,498,996 V3142F probably damaging Het
Alms1 C T 6: 85,677,990 Q3173* probably null Het
Ankrd26 A G 6: 118,523,678 F944S probably benign Het
Arhgap11a G T 2: 113,841,994 H210N probably benign Het
Brca1 T C 11: 101,525,287 N674D probably benign Het
Bud13 T A 9: 46,298,495 V634E probably damaging Het
Capn13 C T 17: 73,339,484 M311I possibly damaging Het
Cdyl2 T C 8: 116,579,164 probably null Het
Celsr3 T C 9: 108,843,302 probably null Het
Col6a5 C G 9: 105,945,914 E81D unknown Het
Ctbs C A 3: 146,450,613 H38N probably benign Het
Ctnnd1 T C 2: 84,603,701 D897G possibly damaging Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Dnttip2 G A 3: 122,280,761 E616K probably damaging Het
Epb41l5 A T 1: 119,608,093 S348R probably damaging Het
Fam185a A G 5: 21,425,454 H96R probably benign Het
Fbxo11 T C 17: 88,009,108 D279G possibly damaging Het
Gm3952 C A 8: 128,759,865 G1578V probably damaging Het
Grb7 T A 11: 98,455,055 probably benign Het
Grik1 A G 16: 87,946,728 V537A probably benign Het
H2-Eb2 T A 17: 34,333,326 N48K probably benign Het
Kank3 A G 17: 33,822,263 probably benign Het
Klhl35 A T 7: 99,473,851 probably null Het
Lpxn T C 19: 12,833,235 F348L probably damaging Het
Mef2d A G 3: 88,158,303 Y114C possibly damaging Het
Mfap3 T A 11: 57,529,703 L170H probably damaging Het
Mical1 C G 10: 41,481,628 F410L possibly damaging Het
Mppe1 G A 18: 67,228,068 S206F probably benign Het
Myo9b C T 8: 71,359,624 A2013V possibly damaging Het
Phactr3 T C 2: 178,283,109 V243A possibly damaging Het
Ppp4r4 T C 12: 103,558,445 L92P probably damaging Het
Rap1gds1 C T 3: 138,959,090 D236N probably damaging Het
Rnf8 T C 17: 29,631,668 probably benign Het
Rpl31-ps17 C T 12: 54,701,649 noncoding transcript Het
Sfta2 T C 17: 35,628,165 probably null Het
Sipa1l2 T A 8: 125,491,672 T309S probably benign Het
Sos1 T C 17: 80,398,584 D1186G probably benign Het
Sptb C A 12: 76,613,010 V1039F probably benign Het
Sycp3 T C 10: 88,463,375 V68A probably benign Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Ttc3 G A 16: 94,422,277 R253H probably damaging Het
Ugt1a7c A G 1: 88,095,727 T203A possibly damaging Het
Vtcn1 A T 3: 100,888,209 E164V probably damaging Het
Zan T C 5: 137,463,555 T1121A unknown Het
Zfp473 T C 7: 44,732,252 I885V probably benign Het
Zfp990 A T 4: 145,536,977 probably null Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R0426:Kifap3 UTSW 1 163865552 splice site probably benign
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2273:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R6744:Kifap3 UTSW 1 163848670 missense probably benign 0.00
R7051:Kifap3 UTSW 1 163794080 missense probably damaging 1.00
R7143:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7467:Kifap3 UTSW 1 163815833 missense probably benign
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
R8108:Kifap3 UTSW 1 163797362 missense probably damaging 0.99
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Z1177:Kifap3 UTSW 1 163862062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGTGACATTCCATGGCCC -3'
(R):5'- TATTCACCTCGAGATGTGGC -3'

Sequencing Primer
(F):5'- ATTCCATGGCCCTGACAATGAGG -3'
(R):5'- CAGTGGAGCATCAACCGTATTTAAC -3'
Posted On2015-06-10