Incidental Mutation 'R4194:Tas1r3'
ID318474
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Nametaste receptor, type 1, member 3
SynonymsT1r3
MMRRC Submission 041025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4194 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155859268-155863362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155862985 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 81 (E81G)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000151961] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030949
AA Change: E81G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: E81G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect probably benign
Transcript: ENSMUST00000151961
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.7045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,071 V226E probably damaging Het
Adamtsl1 A T 4: 86,054,008 probably benign Het
Adgrv1 C A 13: 81,498,996 V3142F probably damaging Het
Alms1 C T 6: 85,677,990 Q3173* probably null Het
Ankrd26 A G 6: 118,523,678 F944S probably benign Het
Arhgap11a G T 2: 113,841,994 H210N probably benign Het
Brca1 T C 11: 101,525,287 N674D probably benign Het
Bud13 T A 9: 46,298,495 V634E probably damaging Het
Capn13 C T 17: 73,339,484 M311I possibly damaging Het
Cdyl2 T C 8: 116,579,164 probably null Het
Celsr3 T C 9: 108,843,302 probably null Het
Col6a5 C G 9: 105,945,914 E81D unknown Het
Ctbs C A 3: 146,450,613 H38N probably benign Het
Ctnnd1 T C 2: 84,603,701 D897G possibly damaging Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Dnttip2 G A 3: 122,280,761 E616K probably damaging Het
Epb41l5 A T 1: 119,608,093 S348R probably damaging Het
Fam185a A G 5: 21,425,454 H96R probably benign Het
Fbxo11 T C 17: 88,009,108 D279G possibly damaging Het
Gm3952 C A 8: 128,759,865 G1578V probably damaging Het
Grb7 T A 11: 98,455,055 probably benign Het
Grik1 A G 16: 87,946,728 V537A probably benign Het
H2-Eb2 T A 17: 34,333,326 N48K probably benign Het
Kank3 A G 17: 33,822,263 probably benign Het
Kifap3 T C 1: 163,915,825 S792P probably benign Het
Klhl35 A T 7: 99,473,851 probably null Het
Lpxn T C 19: 12,833,235 F348L probably damaging Het
Mef2d A G 3: 88,158,303 Y114C possibly damaging Het
Mfap3 T A 11: 57,529,703 L170H probably damaging Het
Mical1 C G 10: 41,481,628 F410L possibly damaging Het
Mppe1 G A 18: 67,228,068 S206F probably benign Het
Myo9b C T 8: 71,359,624 A2013V possibly damaging Het
Phactr3 T C 2: 178,283,109 V243A possibly damaging Het
Ppp4r4 T C 12: 103,558,445 L92P probably damaging Het
Rap1gds1 C T 3: 138,959,090 D236N probably damaging Het
Rnf8 T C 17: 29,631,668 probably benign Het
Rpl31-ps17 C T 12: 54,701,649 noncoding transcript Het
Sfta2 T C 17: 35,628,165 probably null Het
Sipa1l2 T A 8: 125,491,672 T309S probably benign Het
Sos1 T C 17: 80,398,584 D1186G probably benign Het
Sptb C A 12: 76,613,010 V1039F probably benign Het
Sycp3 T C 10: 88,463,375 V68A probably benign Het
Ttc3 G A 16: 94,422,277 R253H probably damaging Het
Ugt1a7c A G 1: 88,095,727 T203A possibly damaging Het
Vtcn1 A T 3: 100,888,209 E164V probably damaging Het
Zan T C 5: 137,463,555 T1121A unknown Het
Zfp473 T C 7: 44,732,252 I885V probably benign Het
Zfp990 A T 4: 145,536,977 probably null Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155861327 missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155861359 missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155860662 missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155860460 missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155862359 missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155861843 unclassified probably benign
IGL03407:Tas1r3 APN 4 155861982 unclassified probably null
R0122:Tas1r3 UTSW 4 155860833 missense probably benign
R0827:Tas1r3 UTSW 4 155860869 missense probably benign 0.02
R1700:Tas1r3 UTSW 4 155861570 missense probably benign
R1803:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155862153 missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155862920 missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155862131 missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155862218 missense possibly damaging 0.58
R2316:Tas1r3 UTSW 4 155863315 missense probably benign
R2847:Tas1r3 UTSW 4 155860202 missense probably benign 0.08
R3619:Tas1r3 UTSW 4 155860953 missense probably damaging 0.99
R3870:Tas1r3 UTSW 4 155861353 missense probably damaging 1.00
R4195:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155862332 missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155862065 missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155860800 missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155862904 missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155862826 missense probably damaging 1.00
R7490:Tas1r3 UTSW 4 155862023 missense probably damaging 0.97
R7895:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
R7978:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTGCCTGTAATGAGGG -3'
(R):5'- ATCCCGTGCAACAGGTATGG -3'

Sequencing Primer
(F):5'- CCTGTAATGAGGGCAAGCTCTG -3'
(R):5'- CAGGTATGGAGGCTAGTAGCTG -3'
Posted On2015-06-10