Mutagenetix > Incidental Mutation

Incidental Mutation 'R4194:Alms1'

318478

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

MMRRC Submission

041025-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4194 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 85677990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 3173 (Q3173*)

Ref Sequence

ENSEMBL: ENSMUSP00000148796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000072018
AA Change: Q2704*

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: Q2704*

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202081

Predicted Effect

probably null
Transcript: ENSMUST00000213058
AA Change: Q3173*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	T	6: 40,921,071	V226E	probably damaging	Het
Adamtsl1	A	T	4: 86,054,008		probably benign	Het
Adgrv1	C	A	13: 81,498,996	V3142F	probably damaging	Het
Ankrd26	A	G	6: 118,523,678	F944S	probably benign	Het
Arhgap11a	G	T	2: 113,841,994	H210N	probably benign	Het
Brca1	T	C	11: 101,525,287	N674D	probably benign	Het
Bud13	T	A	9: 46,298,495	V634E	probably damaging	Het
Capn13	C	T	17: 73,339,484	M311I	possibly damaging	Het
Cdyl2	T	C	8: 116,579,164		probably null	Het
Celsr3	T	C	9: 108,843,302		probably null	Het
Col6a5	C	G	9: 105,945,914	E81D	unknown	Het
Ctbs	C	A	3: 146,450,613	H38N	probably benign	Het
Ctnnd1	T	C	2: 84,603,701	D897G	possibly damaging	Het
Cyp2d41-ps	T	C	15: 82,781,953		noncoding transcript	Het
Dnttip2	G	A	3: 122,280,761	E616K	probably damaging	Het
Epb41l5	A	T	1: 119,608,093	S348R	probably damaging	Het
Fam185a	A	G	5: 21,425,454	H96R	probably benign	Het
Fbxo11	T	C	17: 88,009,108	D279G	possibly damaging	Het
Gm3952	C	A	8: 128,759,865	G1578V	probably damaging	Het
Grb7	T	A	11: 98,455,055		probably benign	Het
Grik1	A	G	16: 87,946,728	V537A	probably benign	Het
H2-Eb2	T	A	17: 34,333,326	N48K	probably benign	Het
Kank3	A	G	17: 33,822,263		probably benign	Het
Kifap3	T	C	1: 163,915,825	S792P	probably benign	Het
Klhl35	A	T	7: 99,473,851		probably null	Het
Lpxn	T	C	19: 12,833,235	F348L	probably damaging	Het
Mef2d	A	G	3: 88,158,303	Y114C	possibly damaging	Het
Mfap3	T	A	11: 57,529,703	L170H	probably damaging	Het
Mical1	C	G	10: 41,481,628	F410L	possibly damaging	Het
Mppe1	G	A	18: 67,228,068	S206F	probably benign	Het
Myo9b	C	T	8: 71,359,624	A2013V	possibly damaging	Het
Phactr3	T	C	2: 178,283,109	V243A	possibly damaging	Het
Ppp4r4	T	C	12: 103,558,445	L92P	probably damaging	Het
Rap1gds1	C	T	3: 138,959,090	D236N	probably damaging	Het
Rnf8	T	C	17: 29,631,668		probably benign	Het
Rpl31-ps17	C	T	12: 54,701,649		noncoding transcript	Het
Sfta2	T	C	17: 35,628,165		probably null	Het
Sipa1l2	T	A	8: 125,491,672	T309S	probably benign	Het
Sos1	T	C	17: 80,398,584	D1186G	probably benign	Het
Sptb	C	A	12: 76,613,010	V1039F	probably benign	Het
Sycp3	T	C	10: 88,463,375	V68A	probably benign	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Ttc3	G	A	16: 94,422,277	R253H	probably damaging	Het
Ugt1a7c	A	G	1: 88,095,727	T203A	possibly damaging	Het
Vtcn1	A	T	3: 100,888,209	E164V	probably damaging	Het
Zan	T	C	5: 137,463,555	T1121A	unknown	Het
Zfp473	T	C	7: 44,732,252	I885V	probably benign	Het
Zfp990	A	T	4: 145,536,977		probably null	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0491:Alms1	UTSW	6	85702600	missense	probably damaging	0.98
R0510:Alms1	UTSW	6	85620369	nonsense	probably null
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0637:Alms1	UTSW	6	85623033	missense	possibly damaging	0.85
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1699:Alms1	UTSW	6	85622880	missense	possibly damaging	0.46
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R1836:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4539:Alms1	UTSW	6	85620478	missense	possibly damaging	0.78
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- AGAGCCTCAGCATCAACTTG -3'
(R):5'- CTAAAGTCCCCTGTACTCTGGC -3'

Sequencing Primer
(F):5'- CCTCAGCATCAACTTGAATTTGGGAG -3'
(R):5'- GTACTCTGGCCCCTCTCTAGG -3'

Posted On

2015-06-10