Incidental Mutation 'R4194:Brca1'
ID318494
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 041025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4194 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101525287 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 674 (N674D)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: N674D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: N674D

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Predicted Effect probably benign
Transcript: ENSMUST00000142086
SMART Domains Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
RING 24 64 8.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188168
Predicted Effect probably benign
Transcript: ENSMUST00000191198
SMART Domains Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

DomainStartEndE-ValueType
Pfam:EIN3 1 146 3.5e-18 PFAM
Meta Mutation Damage Score 0.2282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,071 V226E probably damaging Het
Adamtsl1 A T 4: 86,054,008 probably benign Het
Adgrv1 C A 13: 81,498,996 V3142F probably damaging Het
Alms1 C T 6: 85,677,990 Q3173* probably null Het
Ankrd26 A G 6: 118,523,678 F944S probably benign Het
Arhgap11a G T 2: 113,841,994 H210N probably benign Het
Bud13 T A 9: 46,298,495 V634E probably damaging Het
Capn13 C T 17: 73,339,484 M311I possibly damaging Het
Cdyl2 T C 8: 116,579,164 probably null Het
Celsr3 T C 9: 108,843,302 probably null Het
Col6a5 C G 9: 105,945,914 E81D unknown Het
Ctbs C A 3: 146,450,613 H38N probably benign Het
Ctnnd1 T C 2: 84,603,701 D897G possibly damaging Het
Cyp2d41-ps T C 15: 82,781,953 noncoding transcript Het
Dnttip2 G A 3: 122,280,761 E616K probably damaging Het
Epb41l5 A T 1: 119,608,093 S348R probably damaging Het
Fam185a A G 5: 21,425,454 H96R probably benign Het
Fbxo11 T C 17: 88,009,108 D279G possibly damaging Het
Gm3952 C A 8: 128,759,865 G1578V probably damaging Het
Grb7 T A 11: 98,455,055 probably benign Het
Grik1 A G 16: 87,946,728 V537A probably benign Het
H2-Eb2 T A 17: 34,333,326 N48K probably benign Het
Kank3 A G 17: 33,822,263 probably benign Het
Kifap3 T C 1: 163,915,825 S792P probably benign Het
Klhl35 A T 7: 99,473,851 probably null Het
Lpxn T C 19: 12,833,235 F348L probably damaging Het
Mef2d A G 3: 88,158,303 Y114C possibly damaging Het
Mfap3 T A 11: 57,529,703 L170H probably damaging Het
Mical1 C G 10: 41,481,628 F410L possibly damaging Het
Mppe1 G A 18: 67,228,068 S206F probably benign Het
Myo9b C T 8: 71,359,624 A2013V possibly damaging Het
Phactr3 T C 2: 178,283,109 V243A possibly damaging Het
Ppp4r4 T C 12: 103,558,445 L92P probably damaging Het
Rap1gds1 C T 3: 138,959,090 D236N probably damaging Het
Rnf8 T C 17: 29,631,668 probably benign Het
Rpl31-ps17 C T 12: 54,701,649 noncoding transcript Het
Sfta2 T C 17: 35,628,165 probably null Het
Sipa1l2 T A 8: 125,491,672 T309S probably benign Het
Sos1 T C 17: 80,398,584 D1186G probably benign Het
Sptb C A 12: 76,613,010 V1039F probably benign Het
Sycp3 T C 10: 88,463,375 V68A probably benign Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Ttc3 G A 16: 94,422,277 R253H probably damaging Het
Ugt1a7c A G 1: 88,095,727 T203A possibly damaging Het
Vtcn1 A T 3: 100,888,209 E164V probably damaging Het
Zan T C 5: 137,463,555 T1121A unknown Het
Zfp473 T C 7: 44,732,252 I885V probably benign Het
Zfp990 A T 4: 145,536,977 probably null Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4571:Brca1 UTSW 11 101517366 missense probably benign 0.00
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGAGTTCTTTGGCACTGTCAG -3'
(R):5'- AGGAGGAAGTCTTCTATCAGGTG -3'

Sequencing Primer
(F):5'- GCACTGTCAGACATTTGGC -3'
(R):5'- AGGTGTGCTCTTCCACTTGAAC -3'
Posted On2015-06-10