Incidental Mutation 'R4195:Cnnm4'
ID318513
Institutional Source Beutler Lab
Gene Symbol Cnnm4
Ensembl Gene ENSMUSG00000037408
Gene Namecyclin M4
Synonyms5430430O18Rik, Acdp4
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4195 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36471620-36508764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36499508 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 590 (H590Q)
Ref Sequence ENSEMBL: ENSMUSP00000121317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153128]
Predicted Effect probably benign
Transcript: ENSMUST00000153128
AA Change: H590Q

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121317
Gene: ENSMUSG00000037408
AA Change: H590Q

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:DUF21 181 355 1.1e-35 PFAM
SCOP:d1jr1a3 373 424 1e-3 SMART
Blast:CBS 379 429 9e-13 BLAST
Pfam:CBS 438 502 6.9e-4 PFAM
Blast:cNMP 572 705 2e-72 BLAST
Meta Mutation Damage Score 0.1040 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play a role in metal ion transport. Mutations in this gene are associated with Jalili syndrome which consists of cone-rod dystrophy and amelogenesis imperfecta. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutants exhibit hypomagnesemia and defective amelogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Cnnm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Cnnm4 APN 1 36498034 missense possibly damaging 0.95
IGL01534:Cnnm4 APN 1 36499515 missense probably benign
IGL02201:Cnnm4 APN 1 36472750 missense probably damaging 1.00
IGL03090:Cnnm4 APN 1 36471871 missense probably benign 0.00
IGL03173:Cnnm4 APN 1 36473092 splice site probably benign
R0372:Cnnm4 UTSW 1 36498010 missense probably damaging 1.00
R1659:Cnnm4 UTSW 1 36472165 missense probably benign 0.00
R2239:Cnnm4 UTSW 1 36505678 missense probably benign 0.00
R2986:Cnnm4 UTSW 1 36472372 missense possibly damaging 0.92
R4890:Cnnm4 UTSW 1 36472264 missense probably benign 0.35
R6109:Cnnm4 UTSW 1 36498479 missense probably damaging 1.00
R6302:Cnnm4 UTSW 1 36499955 missense probably benign
R7773:Cnnm4 UTSW 1 36499522 missense probably benign
R7836:Cnnm4 UTSW 1 36471938 missense probably benign
R8041:Cnnm4 UTSW 1 36472093 missense probably benign 0.01
R8222:Cnnm4 UTSW 1 36506536 missense probably benign 0.04
X0011:Cnnm4 UTSW 1 36472906 missense probably damaging 1.00
Z1176:Cnnm4 UTSW 1 36505751 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGGGAGGAAGCCATTCTAG -3'
(R):5'- GATGACACACAACCTGGAGC -3'

Sequencing Primer
(F):5'- CTAGTACAGAGTGGCGTGGTCAC -3'
(R):5'- GCACATTCAAGGGTAGGCC -3'
Posted On2015-06-10