Mutagenetix > Incidental Mutations

Incidental Mutation 'R4195:Mrps9'

318514

Institutional Source

Beutler Lab

Gene Symbol

Mrps9

Ensembl Gene

ENSMUSG00000060679

Gene Name

mitochondrial ribosomal protein S9

Synonyms

MMRRC Submission

041026-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R4195 (G1)

Quality Score

221

Status

Validated

Chromosome

Chromosomal Location

42851233-42905683 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to G at 42901094 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057208]

Predicted Effect

probably benign
Transcript: ENSMUST00000057208

SMART Domains

Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	194	207	N/A	INTRINSIC
Pfam:Ribosomal_S9	268	390	7.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187414

Predicted Effect

probably benign
Transcript: ENSMUST00000201108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202358

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atl3	A	G	19: 7,518,546	I171V	possibly damaging	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cacna1f	A	G	X: 7,608,930	H57R	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Lman2l	A	C	1: 36,424,941	I266M	probably damaging	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Olfr266	A	T	3: 106,822,012	C182*	probably null	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Mrps9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Mrps9	APN	1	42905459	missense	probably damaging	1.00
IGL01134:Mrps9	APN	1	42903397	missense	probably damaging	0.97
IGL01557:Mrps9	APN	1	42851350	missense	probably benign
IGL02541:Mrps9	APN	1	42862654	splice site	probably null
PIT4402001:Mrps9	UTSW	1	42896098	missense	probably benign	0.10
R0598:Mrps9	UTSW	1	42905417	missense	probably damaging	1.00
R1718:Mrps9	UTSW	1	42903399	missense	probably damaging	1.00
R4196:Mrps9	UTSW	1	42901094	intron	probably benign
R4695:Mrps9	UTSW	1	42862515	missense	possibly damaging	0.59
R4840:Mrps9	UTSW	1	42898415	intron	probably benign
R5033:Mrps9	UTSW	1	42895331	splice site	probably null
R5489:Mrps9	UTSW	1	42898433	splice site	probably benign
R5876:Mrps9	UTSW	1	42895378	missense	probably damaging	0.99
R6891:Mrps9	UTSW	1	42905413	missense	probably damaging	1.00
R7015:Mrps9	UTSW	1	42898546	missense	probably benign	0.04
R7940:Mrps9	UTSW	1	42862648	missense	probably damaging	0.98
Z1177:Mrps9	UTSW	1	42899458	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGCGAAAGATGTCAGTGCCTAC -3'
(R):5'- GTAAAATGGCAGCCCTCACAG -3'

Sequencing Primer
(F):5'- AGATGTCAGTGCCTACTATTAGATGG -3'
(R):5'- TCACAGAAATAACCCTGGGAGG -3'

Posted On

2015-06-10