Incidental Mutation 'R4195:Acmsd'
ID 318516
Institutional Source Beutler Lab
Gene Symbol Acmsd
Ensembl Gene ENSMUSG00000026348
Gene Name amino carboxymuconate semialdehyde decarboxylase
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4195 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 127729413-127767978 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 127749194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 152 (L152R)
Ref Sequence ENSEMBL: ENSMUSP00000048482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038006]
AlphaFold Q8R519
Predicted Effect probably damaging
Transcript: ENSMUST00000038006
AA Change: L152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048482
Gene: ENSMUSG00000026348
AA Change: L152R

DomainStartEndE-ValueType
Pfam:Amidohydro_2 3 330 7.8e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188163
Meta Mutation Damage Score 0.9200 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase; EC 4.1.1.45) can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Acmsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Acmsd APN 1 127759710 missense probably damaging 1.00
IGL02203:Acmsd APN 1 127738605 splice site probably benign
IGL02209:Acmsd APN 1 127759755 missense probably damaging 1.00
IGL02429:Acmsd APN 1 127759716 missense probably damaging 1.00
IGL02577:Acmsd APN 1 127739959 missense probably benign 0.05
IGL02724:Acmsd APN 1 127749085 missense possibly damaging 0.84
IGL03215:Acmsd APN 1 127758013 nonsense probably null
H8562:Acmsd UTSW 1 127749058 missense probably benign
R0535:Acmsd UTSW 1 127765943 missense probably benign 0.10
R0551:Acmsd UTSW 1 127766333 missense probably benign 0.05
R0593:Acmsd UTSW 1 127738603 splice site probably benign
R1282:Acmsd UTSW 1 127738560 missense probably damaging 0.99
R1633:Acmsd UTSW 1 127753855 missense probably benign 0.33
R1800:Acmsd UTSW 1 127759756 nonsense probably null
R3018:Acmsd UTSW 1 127749116 missense probably benign 0.11
R4196:Acmsd UTSW 1 127749194 missense probably damaging 1.00
R4288:Acmsd UTSW 1 127738572 missense probably damaging 1.00
R4591:Acmsd UTSW 1 127749197 missense probably damaging 0.99
R5172:Acmsd UTSW 1 127753848 nonsense probably null
R5637:Acmsd UTSW 1 127766313 missense probably damaging 0.99
R6147:Acmsd UTSW 1 127729420 start gained probably benign
R7055:Acmsd UTSW 1 127753833 missense probably benign 0.10
R7261:Acmsd UTSW 1 127759824 missense probably damaging 1.00
R7398:Acmsd UTSW 1 127729435 start gained probably benign
R8030:Acmsd UTSW 1 127749161 missense possibly damaging 0.50
R9081:Acmsd UTSW 1 127759731 missense possibly damaging 0.94
X0067:Acmsd UTSW 1 127759731 missense probably benign 0.42
Z1176:Acmsd UTSW 1 127745802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTTGGAGCTGTGCCAG -3'
(R):5'- CTTGGAAGTGTCCCATCATCCC -3'

Sequencing Primer
(F):5'- GGAGCTGTGCCAGTTTTTAAACAATG -3'
(R):5'- AGAATGATACACTCTTTTGGGAGG -3'
Posted On 2015-06-10