Incidental Mutation 'R4195:Nmi'
ID318518
Institutional Source Beutler Lab
Gene Symbol Nmi
Ensembl Gene ENSMUSG00000026946
Gene NameN-myc (and STAT) interactor
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4195 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location51948487-51973494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 51948620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 301 (S301A)
Ref Sequence ENSEMBL: ENSMUSP00000120647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028314] [ENSMUST00000112705] [ENSMUST00000142868] [ENSMUST00000145481]
Predicted Effect probably benign
Transcript: ENSMUST00000028314
AA Change: S301A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028314
Gene: ENSMUSG00000026946
AA Change: S301A

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 7.6e-39 PFAM
Pfam:NID 106 193 3.7e-49 PFAM
Pfam:NID 204 292 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112705
AA Change: S301A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108325
Gene: ENSMUSG00000026946
AA Change: S301A

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 7.6e-39 PFAM
Pfam:NID 106 193 3.7e-49 PFAM
Pfam:NID 204 292 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142868
SMART Domains Protein: ENSMUSP00000115428
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:NID 1 26 3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145481
AA Change: S301A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120647
Gene: ENSMUSG00000026946
AA Change: S301A

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 3.7e-41 PFAM
Pfam:NID 106 193 7.3e-34 PFAM
Pfam:NID 204 292 2.9e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NMYC interactor (NMI) encodes a protein that interacts with NMYC and CMYC (two members of the oncogene Myc family), and other transcription factors containing a Zip, HLH, or HLH-Zip motif. The NMI protein also interacts with all STATs except STAT2 and augments STAT-mediated transcription in response to cytokines IL2 and IFN-gamma. The NMI mRNA has low expression levels in all human fetal and adult tissues tested except brain and has high expression in cancer cell line-myeloid leukemias. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Nmi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Nmi APN 2 51956040 unclassified probably null
IGL02041:Nmi APN 2 51960629 missense possibly damaging 0.72
IGL02299:Nmi APN 2 51958964 missense probably damaging 1.00
IGL03144:Nmi APN 2 51952534 missense probably damaging 1.00
R1589:Nmi UTSW 2 51958977 missense possibly damaging 0.62
R1961:Nmi UTSW 2 51948620 missense probably benign 0.01
R2114:Nmi UTSW 2 51948707 missense probably benign 0.30
R2115:Nmi UTSW 2 51948707 missense probably benign 0.30
R2116:Nmi UTSW 2 51948707 missense probably benign 0.30
R2151:Nmi UTSW 2 51952543 missense probably damaging 1.00
R2153:Nmi UTSW 2 51952543 missense probably damaging 1.00
R3964:Nmi UTSW 2 51956069 missense possibly damaging 0.85
R4650:Nmi UTSW 2 51948634 missense probably benign 0.33
R6573:Nmi UTSW 2 51950069 missense possibly damaging 0.55
R7129:Nmi UTSW 2 51955924 critical splice donor site probably null
R7369:Nmi UTSW 2 51950084 missense possibly damaging 0.85
R7520:Nmi UTSW 2 51952480 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTGTAAACACACAGCAGAGC -3'
(R):5'- GAACACATCCCTTCAGTTGCC -3'

Sequencing Primer
(F):5'- TTGTAAACACACAGCAGAGCTCAAAC -3'
(R):5'- CCCTTCAGTTGCCATAATAATTTAGC -3'
Posted On2015-06-10