Incidental Mutation 'R4195:Mtmr11'
ID318525
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Namemyotubularin related protein 11
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4195 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96162004-96171718 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 96167891 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably benign
Transcript: ENSMUST00000054356
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123520
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96164991 intron probably benign
R1017:Mtmr11 UTSW 3 96164477 missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96168113 missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96164786 missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96169097 missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96165266 missense probably damaging 1.00
R4243:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4245:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96167891 splice site probably benign
R4417:Mtmr11 UTSW 3 96167891 splice site probably benign
R4461:Mtmr11 UTSW 3 96167891 splice site probably benign
R4468:Mtmr11 UTSW 3 96167891 splice site probably benign
R4963:Mtmr11 UTSW 3 96163250 intron probably benign
R5134:Mtmr11 UTSW 3 96169907 missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96164319 missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96163767 missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96167869 missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96171202 missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96168589 splice site probably null
R6084:Mtmr11 UTSW 3 96168084 missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96168676 missense probably benign 0.07
R6446:Mtmr11 UTSW 3 96171188 missense probably benign 0.00
R6821:Mtmr11 UTSW 3 96170407 missense probably benign
R7033:Mtmr11 UTSW 3 96169946 missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96164538 missense possibly damaging 0.68
R7878:Mtmr11 UTSW 3 96169199 missense probably benign 0.00
R7899:Mtmr11 UTSW 3 96170428 missense probably damaging 1.00
X0019:Mtmr11 UTSW 3 96164492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGACTTCTTATCCCATCTG -3'
(R):5'- CTGGAAGGGCGTGTGATGA -3'

Sequencing Primer
(F):5'- CATAGTCAGCTGCTGTGGACAATC -3'
(R):5'- TGATGAAGAAGGGAGTAATGTATTGG -3'
Posted On2015-06-10