Mutagenetix > Incidental Mutations

Incidental Mutation 'R4195:Mtmr11'

318525

Institutional Source

Beutler Lab

Gene Symbol

Mtmr11

Ensembl Gene

ENSMUSG00000045934

Gene Name

myotubularin related protein 11

Synonyms

MMRRC Submission

041026-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R4195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96162004-96171718 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 96167891 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]

AlphaFold

Q3V1L6

Predicted Effect

probably benign
Transcript: ENSMUST00000054356

SMART Domains

Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	191	323	1.7e-12	PFAM
Pfam:Myotub-related	312	488	1.3e-44	PFAM
Pfam:3-PAP	550	683	2.3e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000076372

SMART Domains

Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

Domain	Start	End	E-Value	Type
RRM	14	87	1.46e-25	SMART
RRM	101	175	5.07e-25	SMART
low complexity region	214	307	N/A	INTRINSIC
low complexity region	310	423	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123520

Predicted Effect

probably benign
Transcript: ENSMUST00000129925

SMART Domains

Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

Domain	Start	End	E-Value	Type
Pfam:Myotub-related	162	264	4.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147245

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153977

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154955

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196004

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199721

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atl3	A	G	19: 7,518,546	I171V	possibly damaging	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cacna1f	A	G	X: 7,608,930	H57R	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Lman2l	A	C	1: 36,424,941	I266M	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Olfr266	A	T	3: 106,822,012	C182*	probably null	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Mtmr11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02539:Mtmr11	APN	3	96164991	intron	probably benign
R1017:Mtmr11	UTSW	3	96164477	missense	probably damaging	1.00
R1589:Mtmr11	UTSW	3	96168113	missense	probably benign	0.16
R1836:Mtmr11	UTSW	3	96164786	missense	probably damaging	0.98
R2264:Mtmr11	UTSW	3	96169097	missense	possibly damaging	0.53
R3623:Mtmr11	UTSW	3	96165266	missense	probably damaging	1.00
R4243:Mtmr11	UTSW	3	96168077	missense	probably damaging	1.00
R4245:Mtmr11	UTSW	3	96168077	missense	probably damaging	1.00
R4414:Mtmr11	UTSW	3	96167891	splice site	probably benign
R4417:Mtmr11	UTSW	3	96167891	splice site	probably benign
R4461:Mtmr11	UTSW	3	96167891	splice site	probably benign
R4468:Mtmr11	UTSW	3	96167891	splice site	probably benign
R4963:Mtmr11	UTSW	3	96163250	intron	probably benign
R5134:Mtmr11	UTSW	3	96169907	missense	probably damaging	1.00
R5154:Mtmr11	UTSW	3	96164319	missense	probably benign	0.03
R5508:Mtmr11	UTSW	3	96163767	missense	probably damaging	1.00
R5821:Mtmr11	UTSW	3	96167869	missense	possibly damaging	0.91
R5868:Mtmr11	UTSW	3	96171202	missense	possibly damaging	0.65
R5991:Mtmr11	UTSW	3	96168589	splice site	probably null
R6084:Mtmr11	UTSW	3	96168084	missense	probably damaging	0.99
R6354:Mtmr11	UTSW	3	96168676	missense	probably benign	0.07
R6446:Mtmr11	UTSW	3	96171188	missense	probably benign	0.00
R6821:Mtmr11	UTSW	3	96170407	missense	probably benign
R7033:Mtmr11	UTSW	3	96169946	missense	probably damaging	1.00
R7312:Mtmr11	UTSW	3	96164538	missense	possibly damaging	0.68
R7878:Mtmr11	UTSW	3	96169199	missense	probably benign	0.00
R7899:Mtmr11	UTSW	3	96170428	missense	probably damaging	1.00
R8479:Mtmr11	UTSW	3	96163734	missense	probably damaging	1.00
R8923:Mtmr11	UTSW	3	96164871	missense	probably damaging	1.00
X0019:Mtmr11	UTSW	3	96164492	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCAGACTTCTTATCCCATCTG -3'
(R):5'- CTGGAAGGGCGTGTGATGA -3'

Sequencing Primer
(F):5'- CATAGTCAGCTGCTGTGGACAATC -3'
(R):5'- TGATGAAGAAGGGAGTAATGTATTGG -3'

Posted On

2015-06-10