Incidental Mutation 'R4195:Mtmr11'
ID 318525
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Name myotubularin related protein 11
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R4195 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 96069321-96079034 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 96075207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
AlphaFold Q3V1L6
Predicted Effect probably benign
Transcript: ENSMUST00000054356
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123520
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,676,931 (GRCm39) L152R probably damaging Het
Actg2 T G 6: 83,500,155 (GRCm39) T39P probably damaging Het
Agap1 A G 1: 89,762,261 (GRCm39) E531G probably damaging Het
Alox12b A G 11: 69,060,426 (GRCm39) S661G probably benign Het
Apod T C 16: 31,116,392 (GRCm39) M113V probably benign Het
Atl3 A G 19: 7,495,911 (GRCm39) I171V possibly damaging Het
Atrn C A 2: 130,775,332 (GRCm39) T145K probably damaging Het
Cacna1f A G X: 7,475,169 (GRCm39) H57R probably damaging Het
Cdhr18 C A 14: 13,829,772 (GRCm38) V657L probably benign Het
Cldn9 T C 17: 23,902,148 (GRCm39) E159G probably damaging Het
Cnnm4 C A 1: 36,538,589 (GRCm39) H590Q probably benign Het
Col19a1 G A 1: 24,573,133 (GRCm39) S213L unknown Het
Cse1l A G 2: 166,771,899 (GRCm39) T387A probably damaging Het
Eif4enif1 T C 11: 3,193,186 (GRCm39) V675A possibly damaging Het
Fbll1 A G 11: 35,688,493 (GRCm39) S257P possibly damaging Het
Fbll1 T A 11: 35,688,699 (GRCm39) H188L possibly damaging Het
Frem2 A G 3: 53,446,689 (GRCm39) F2360L possibly damaging Het
G3bp2 A G 5: 92,203,275 (GRCm39) S349P probably damaging Het
Gm2396 A G 9: 88,799,715 (GRCm39) noncoding transcript Het
Gm6569 C T 15: 73,708,092 (GRCm39) P22L probably damaging Het
Itih2 T C 2: 10,120,096 (GRCm39) N314D probably damaging Het
Lman2l A C 1: 36,464,022 (GRCm39) I266M probably damaging Het
Mrps9 T G 1: 42,940,254 (GRCm39) probably benign Het
Neb G T 2: 52,161,571 (GRCm39) R2074S probably damaging Het
Neb A T 2: 52,180,847 (GRCm39) H1226Q probably damaging Het
Nmi A C 2: 51,838,632 (GRCm39) S301A probably benign Het
Or11i1 A T 3: 106,729,328 (GRCm39) C182* probably null Het
Pclo A G 5: 14,727,577 (GRCm39) probably benign Het
Pkd1l1 T A 11: 8,859,929 (GRCm39) I560F probably damaging Het
Polr1e T C 4: 45,019,327 (GRCm39) Y59H probably damaging Het
Slc30a4 G A 2: 122,527,190 (GRCm39) T401M probably damaging Het
Tas1r3 T C 4: 155,947,442 (GRCm39) E81G probably damaging Het
Zfp990 A T 4: 145,263,547 (GRCm39) probably null Het
Zzz3 A G 3: 152,134,102 (GRCm39) T387A probably benign Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96,072,308 (GRCm39) intron probably benign
R1017:Mtmr11 UTSW 3 96,071,794 (GRCm39) missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96,075,429 (GRCm39) missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96,072,103 (GRCm39) missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96,076,413 (GRCm39) missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96,072,583 (GRCm39) missense probably damaging 1.00
R4243:Mtmr11 UTSW 3 96,075,393 (GRCm39) missense probably damaging 1.00
R4245:Mtmr11 UTSW 3 96,075,393 (GRCm39) missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96,075,207 (GRCm39) splice site probably benign
R4417:Mtmr11 UTSW 3 96,075,207 (GRCm39) splice site probably benign
R4461:Mtmr11 UTSW 3 96,075,207 (GRCm39) splice site probably benign
R4468:Mtmr11 UTSW 3 96,075,207 (GRCm39) splice site probably benign
R4963:Mtmr11 UTSW 3 96,070,567 (GRCm39) intron probably benign
R5134:Mtmr11 UTSW 3 96,077,223 (GRCm39) missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96,071,636 (GRCm39) missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96,071,084 (GRCm39) missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96,075,185 (GRCm39) missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96,078,518 (GRCm39) missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96,075,905 (GRCm39) splice site probably null
R6084:Mtmr11 UTSW 3 96,075,400 (GRCm39) missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96,075,992 (GRCm39) missense probably benign 0.07
R6446:Mtmr11 UTSW 3 96,078,504 (GRCm39) missense probably benign 0.00
R6821:Mtmr11 UTSW 3 96,077,723 (GRCm39) missense probably benign
R7033:Mtmr11 UTSW 3 96,077,262 (GRCm39) missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96,071,855 (GRCm39) missense possibly damaging 0.68
R7878:Mtmr11 UTSW 3 96,076,515 (GRCm39) missense probably benign 0.00
R7899:Mtmr11 UTSW 3 96,077,744 (GRCm39) missense probably damaging 1.00
R8479:Mtmr11 UTSW 3 96,071,051 (GRCm39) missense probably damaging 1.00
R8923:Mtmr11 UTSW 3 96,072,188 (GRCm39) missense probably damaging 1.00
R9376:Mtmr11 UTSW 3 96,072,372 (GRCm39) missense probably benign
R9708:Mtmr11 UTSW 3 96,076,403 (GRCm39) missense possibly damaging 0.93
X0019:Mtmr11 UTSW 3 96,071,809 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAGACTTCTTATCCCATCTG -3'
(R):5'- CTGGAAGGGCGTGTGATGA -3'

Sequencing Primer
(F):5'- CATAGTCAGCTGCTGTGGACAATC -3'
(R):5'- TGATGAAGAAGGGAGTAATGTATTGG -3'
Posted On 2015-06-10