Incidental Mutation 'R4195:Olfr266'
ID 318526
Institutional Source Beutler Lab
Gene Symbol Olfr266
Ensembl Gene ENSMUSG00000043529
Gene Name olfactory receptor 266
Synonyms MOR122-2, GA_x6K02T2N6GK-529983-529033
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R4195 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 106820485-106826287 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 106822012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 182 (C182*)
Ref Sequence ENSEMBL: ENSMUSP00000150519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059486] [ENSMUST00000213616] [ENSMUST00000216610]
AlphaFold Q8VFC3
Predicted Effect probably null
Transcript: ENSMUST00000059486
AA Change: C182*
SMART Domains Protein: ENSMUSP00000054070
Gene: ENSMUSG00000043529
AA Change: C182*

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1.2e-58 PFAM
Pfam:7tm_1 44 293 5.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213616
AA Change: C182*
Predicted Effect probably null
Transcript: ENSMUST00000216610
AA Change: C182*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Olfr266
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Olfr266 APN 3 106822026 missense probably benign 0.25
IGL01954:Olfr266 APN 3 106821995 missense possibly damaging 0.82
IGL02371:Olfr266 APN 3 106822046 missense probably damaging 1.00
IGL02792:Olfr266 APN 3 106822140 missense probably damaging 0.98
PIT4131001:Olfr266 UTSW 3 106821966 missense probably benign 0.00
R0540:Olfr266 UTSW 3 106822513 missense probably damaging 0.99
R1925:Olfr266 UTSW 3 106822372 missense probably damaging 0.98
R2026:Olfr266 UTSW 3 106821711 missense probably benign 0.01
R4735:Olfr266 UTSW 3 106821680 missense probably damaging 1.00
R4789:Olfr266 UTSW 3 106822292 missense possibly damaging 0.94
R4789:Olfr266 UTSW 3 106822308 missense possibly damaging 0.95
R4922:Olfr266 UTSW 3 106822260 missense probably damaging 0.99
R6318:Olfr266 UTSW 3 106822187 missense probably damaging 1.00
R6359:Olfr266 UTSW 3 106822415 missense probably damaging 0.99
R6505:Olfr266 UTSW 3 106822322 missense possibly damaging 0.87
R7605:Olfr266 UTSW 3 106822021 missense probably damaging 1.00
R8529:Olfr266 UTSW 3 106821793 nonsense probably null
R8998:Olfr266 UTSW 3 106821683 missense probably damaging 0.99
R8999:Olfr266 UTSW 3 106821683 missense probably damaging 0.99
R9255:Olfr266 UTSW 3 106822421 missense probably benign 0.00
R9260:Olfr266 UTSW 3 106822194 missense probably damaging 1.00
R9771:Olfr266 UTSW 3 106821744 missense possibly damaging 0.77
Z1176:Olfr266 UTSW 3 106822043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGTGGCAATCAGTGTTCC -3'
(R):5'- ACCGCTACCTAGCTATCTGC -3'

Sequencing Primer
(F):5'- ACAGGTGGAGAAAGCCTTTTTCC -3'
(R):5'- ACCTAGCTATCTGCCAGCC -3'
Posted On 2015-06-10