Mutagenetix > Incidental Mutations

Incidental Mutation 'R4195:Olfr266'

318526

Institutional Source

Beutler Lab

Gene Symbol

Olfr266

Ensembl Gene

ENSMUSG00000043529

Gene Name

olfactory receptor 266

Synonyms

MOR122-2, GA_x6K02T2N6GK-529983-529033

MMRRC Submission

041026-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106820485-106826287 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 106822012 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 182 (C182*)

Ref Sequence

ENSEMBL: ENSMUSP00000150519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059486] [ENSMUST00000213616] [ENSMUST00000216610]

AlphaFold

Q8VFC3

Predicted Effect

probably null
Transcript: ENSMUST00000059486
AA Change: C182*

SMART Domains

Protein: ENSMUSP00000054070
Gene: ENSMUSG00000043529
AA Change: C182*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	34	311	1.2e-58	PFAM
Pfam:7tm_1	44	293	5.4e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000213616
AA Change: C182*

Predicted Effect

probably null
Transcript: ENSMUST00000216610
AA Change: C182*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atl3	A	G	19: 7,518,546	I171V	possibly damaging	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cacna1f	A	G	X: 7,608,930	H57R	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Lman2l	A	C	1: 36,424,941	I266M	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Olfr266

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01869:Olfr266	APN	3	106822026	missense	probably benign	0.25
IGL01954:Olfr266	APN	3	106821995	missense	possibly damaging	0.82
IGL02371:Olfr266	APN	3	106822046	missense	probably damaging	1.00
IGL02792:Olfr266	APN	3	106822140	missense	probably damaging	0.98
PIT4131001:Olfr266	UTSW	3	106821966	missense	probably benign	0.00
R0540:Olfr266	UTSW	3	106822513	missense	probably damaging	0.99
R1925:Olfr266	UTSW	3	106822372	missense	probably damaging	0.98
R2026:Olfr266	UTSW	3	106821711	missense	probably benign	0.01
R4735:Olfr266	UTSW	3	106821680	missense	probably damaging	1.00
R4789:Olfr266	UTSW	3	106822292	missense	possibly damaging	0.94
R4789:Olfr266	UTSW	3	106822308	missense	possibly damaging	0.95
R4922:Olfr266	UTSW	3	106822260	missense	probably damaging	0.99
R6318:Olfr266	UTSW	3	106822187	missense	probably damaging	1.00
R6359:Olfr266	UTSW	3	106822415	missense	probably damaging	0.99
R6505:Olfr266	UTSW	3	106822322	missense	possibly damaging	0.87
R7605:Olfr266	UTSW	3	106822021	missense	probably damaging	1.00
R8529:Olfr266	UTSW	3	106821793	nonsense	probably null
R8998:Olfr266	UTSW	3	106821683	missense	probably damaging	0.99
R8999:Olfr266	UTSW	3	106821683	missense	probably damaging	0.99
Z1176:Olfr266	UTSW	3	106822043	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGGTGGCAATCAGTGTTCC -3'
(R):5'- ACCGCTACCTAGCTATCTGC -3'

Sequencing Primer
(F):5'- ACAGGTGGAGAAAGCCTTTTTCC -3'
(R):5'- ACCTAGCTATCTGCCAGCC -3'

Posted On

2015-06-10