Incidental Mutation 'R4195:Polr1e'
ID 318528
Institutional Source Beutler Lab
Gene Symbol Polr1e
Ensembl Gene ENSMUSG00000028318
Gene Name polymerase (RNA) I polypeptide E
Synonyms 53kDa, D030019D19Rik, Paf53, Praf1
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4195 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 45018583-45036565 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45019327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 59 (Y59H)
Ref Sequence ENSEMBL: ENSMUSP00000121007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029999] [ENSMUST00000107814] [ENSMUST00000133157]
AlphaFold Q8K202
Predicted Effect probably damaging
Transcript: ENSMUST00000029999
AA Change: Y59H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029999
Gene: ENSMUSG00000028318
AA Change: Y59H

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 51 476 2.1e-98 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000054723
AA Change: Y31H
SMART Domains Protein: ENSMUSP00000059941
Gene: ENSMUSG00000028318
AA Change: Y31H

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 24 401 7.9e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095105
Predicted Effect probably damaging
Transcript: ENSMUST00000107814
AA Change: Y59H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103444
Gene: ENSMUSG00000028318
AA Change: Y59H

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 385 4.1e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133157
AA Change: Y59H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121007
Gene: ENSMUSG00000028318
AA Change: Y59H

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 431 1.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186030
Meta Mutation Damage Score 0.5226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Polr1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Polr1e APN 4 45031364 unclassified probably benign
IGL01146:Polr1e APN 4 45031369 missense probably damaging 1.00
IGL01514:Polr1e APN 4 45018723 missense probably benign 0.00
IGL01533:Polr1e APN 4 45019328 missense probably damaging 1.00
R0207:Polr1e UTSW 4 45025143 splice site probably null
R0562:Polr1e UTSW 4 45029421 missense probably damaging 0.99
R0761:Polr1e UTSW 4 45027392 missense probably damaging 0.98
R1472:Polr1e UTSW 4 45028026 missense probably damaging 1.00
R1707:Polr1e UTSW 4 45027469 missense probably damaging 0.99
R2994:Polr1e UTSW 4 45027473 critical splice donor site probably null
R3054:Polr1e UTSW 4 45018724 missense possibly damaging 0.77
R4031:Polr1e UTSW 4 45018685 missense probably benign 0.02
R4771:Polr1e UTSW 4 45019282 missense probably damaging 1.00
R4806:Polr1e UTSW 4 45024482 missense probably benign
R4880:Polr1e UTSW 4 45022280 missense probably damaging 1.00
R4964:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R4966:Polr1e UTSW 4 45029429 missense probably damaging 1.00
R5605:Polr1e UTSW 4 45018723 missense probably benign 0.00
R5934:Polr1e UTSW 4 45029369 missense probably damaging 0.99
R6358:Polr1e UTSW 4 45026813 missense probably damaging 1.00
R7241:Polr1e UTSW 4 45029340 missense probably damaging 1.00
R7436:Polr1e UTSW 4 45024553 splice site probably null
R8952:Polr1e UTSW 4 45018727 missense probably damaging 0.98
X0061:Polr1e UTSW 4 45029436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGACCAGGGCTTTCTTC -3'
(R):5'- CCAAAATCTTGCTCCTCAGTGG -3'

Sequencing Primer
(F):5'- GGACCAGGGCTTTCTTCATACC -3'
(R):5'- GGGCCAGAGTCTCATTTGCTAC -3'
Posted On 2015-06-10