Incidental Mutation 'R4195:Zfp990'
ID318529
Institutional Source Beutler Lab
Gene Symbol Zfp990
Ensembl Gene ENSMUSG00000078503
Gene Namezinc finger protein 990
SynonymsGm13225
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4195 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location145510759-145539188 bp(+) (GRCm38)
Type of Mutationunclassified (2058 bp from exon)
DNA Base Change (assembly) A to T at 145536977 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105741] [ENSMUST00000105742] [ENSMUST00000136309]
Predicted Effect probably damaging
Transcript: ENSMUST00000105741
AA Change: N182Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101367
Gene: ENSMUSG00000078503
AA Change: N182Y

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105742
AA Change: N182Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101368
Gene: ENSMUSG00000078503
AA Change: N182Y

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136309
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Zfp990
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Zfp990 APN 4 145537868 missense probably damaging 0.99
IGL01774:Zfp990 APN 4 145536948 missense probably benign 0.28
IGL01895:Zfp990 APN 4 145536857 missense probably damaging 0.97
IGL01895:Zfp990 APN 4 145536858 missense probably damaging 0.99
IGL02349:Zfp990 APN 4 145530877 utr 5 prime probably benign
IGL02598:Zfp990 APN 4 145536963 missense possibly damaging 0.67
IGL02940:Zfp990 APN 4 145534922 unclassified probably null
IGL03026:Zfp990 APN 4 145537110 missense possibly damaging 0.54
R0007:Zfp990 UTSW 4 145537438 missense probably benign 0.00
R0352:Zfp990 UTSW 4 145536604 missense probably damaging 0.99
R0631:Zfp990 UTSW 4 145537302 missense possibly damaging 0.89
R1490:Zfp990 UTSW 4 145537283 missense probably benign 0.44
R1537:Zfp990 UTSW 4 145536996 missense possibly damaging 0.67
R1832:Zfp990 UTSW 4 145538210 missense possibly damaging 0.51
R1956:Zfp990 UTSW 4 145534882 missense probably damaging 1.00
R1982:Zfp990 UTSW 4 145536869 missense probably damaging 0.99
R2024:Zfp990 UTSW 4 145537404 missense possibly damaging 0.69
R2097:Zfp990 UTSW 4 145537322 missense possibly damaging 0.94
R2235:Zfp990 UTSW 4 145537891 missense probably damaging 0.99
R4194:Zfp990 UTSW 4 145536977 unclassified probably null
R4418:Zfp990 UTSW 4 145536728 missense possibly damaging 0.87
R4617:Zfp990 UTSW 4 145537046 missense possibly damaging 0.59
R4736:Zfp990 UTSW 4 145536942 missense possibly damaging 0.95
R4880:Zfp990 UTSW 4 145537920 missense probably benign
R4941:Zfp990 UTSW 4 145536837 missense probably damaging 1.00
R5014:Zfp990 UTSW 4 145538099 missense possibly damaging 0.93
R5945:Zfp990 UTSW 4 145538043 missense probably damaging 0.98
R6238:Zfp990 UTSW 4 145537913 missense probably damaging 1.00
R6255:Zfp990 UTSW 4 145537789 missense probably benign 0.00
R6267:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6296:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6412:Zfp990 UTSW 4 145537568 missense probably benign 0.00
R6616:Zfp990 UTSW 4 145537145 missense probably benign 0.01
R6701:Zfp990 UTSW 4 145538178 missense probably benign 0.45
R6720:Zfp990 UTSW 4 145536927 missense possibly damaging 0.67
R7015:Zfp990 UTSW 4 145536635 missense probably damaging 0.99
R7487:Zfp990 UTSW 4 145537587 missense probably damaging 1.00
R7722:Zfp990 UTSW 4 145536962 missense possibly damaging 0.86
Z1176:Zfp990 UTSW 4 145536811 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCAGGAACACTAAAGAAGTTTG -3'
(R):5'- ACATTTGTGAGGTGTCTCTCC -3'

Sequencing Primer
(F):5'- GAAGTTTGCAAATACAATGACTCTG -3'
(R):5'- TGAGGTGTCTCTCCTTTATGAATTC -3'
Posted On2015-06-10