Incidental Mutation 'R4195:Tas1r3'
ID318530
Institutional Source Beutler Lab
Gene Symbol Tas1r3
Ensembl Gene ENSMUSG00000029072
Gene Nametaste receptor, type 1, member 3
SynonymsT1r3
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4195 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155859268-155863362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155862985 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 81 (E81G)
Ref Sequence ENSEMBL: ENSMUSP00000030949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000030950] [ENSMUST00000151961] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030949
AA Change: E81G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072
AA Change: E81G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030950
SMART Domains Protein: ENSMUSP00000030950
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 27 179 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect probably benign
Transcript: ENSMUST00000151961
SMART Domains Protein: ENSMUSP00000115935
Gene: ENSMUSG00000029073

DomainStartEndE-ValueType
Pfam:GLTP 25 181 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.7045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in taste responses. The encoded protein can form a heterodimeric receptor with TAS1R1 to elicit the umami taste response, or it can bind with TAS1R2 to form a receptor for the sweet taste response. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutation of this locus affects taste perception. Complete inactivation results in diminished behavioral and nervous repsonses to both sweet and umami tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Tas1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Tas1r3 APN 4 155861327 missense probably benign 0.43
IGL01587:Tas1r3 APN 4 155861359 missense probably damaging 0.99
IGL02314:Tas1r3 APN 4 155860662 missense probably damaging 1.00
IGL02747:Tas1r3 APN 4 155860460 missense possibly damaging 0.92
IGL02999:Tas1r3 APN 4 155862359 missense probably damaging 0.97
IGL03026:Tas1r3 APN 4 155861843 unclassified probably benign
IGL03407:Tas1r3 APN 4 155861982 unclassified probably null
R0122:Tas1r3 UTSW 4 155860833 missense probably benign
R0827:Tas1r3 UTSW 4 155860869 missense probably benign 0.02
R1700:Tas1r3 UTSW 4 155861570 missense probably benign
R1803:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1804:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R1883:Tas1r3 UTSW 4 155862153 missense probably damaging 1.00
R1998:Tas1r3 UTSW 4 155862920 missense probably damaging 1.00
R2061:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2104:Tas1r3 UTSW 4 155862131 missense probably benign 0.26
R2127:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2129:Tas1r3 UTSW 4 155860470 missense probably damaging 0.99
R2237:Tas1r3 UTSW 4 155862218 missense possibly damaging 0.58
R2316:Tas1r3 UTSW 4 155863315 missense probably benign
R2847:Tas1r3 UTSW 4 155860202 missense probably benign 0.08
R3619:Tas1r3 UTSW 4 155860953 missense probably damaging 0.99
R3870:Tas1r3 UTSW 4 155861353 missense probably damaging 1.00
R4194:Tas1r3 UTSW 4 155862985 missense probably damaging 1.00
R4420:Tas1r3 UTSW 4 155862332 missense probably damaging 0.99
R5577:Tas1r3 UTSW 4 155862065 missense probably benign 0.36
R6734:Tas1r3 UTSW 4 155860800 missense probably damaging 1.00
R7006:Tas1r3 UTSW 4 155862904 missense possibly damaging 0.93
R7231:Tas1r3 UTSW 4 155862826 missense probably damaging 1.00
R7490:Tas1r3 UTSW 4 155862023 missense probably damaging 0.97
R7895:Tas1r3 UTSW 4 155862548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAACTTGCCTGTAATGAGGG -3'
(R):5'- CATCCCGTGCAACAGGTATG -3'

Sequencing Primer
(F):5'- CCTGTAATGAGGGCAAGCTCTG -3'
(R):5'- CAGGTATGGAGGCTAGTAGCTG -3'
Posted On2015-06-10