Mutagenetix > Incidental Mutation

Incidental Mutation 'R4195:Eif4enif1'

318535

Institutional Source

Beutler Lab

Gene Symbol

Eif4enif1

Ensembl Gene

ENSMUSG00000020454

Gene Name

eukaryotic translation initiation factor 4E nuclear import factor 1

Synonyms

D11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik

MMRRC Submission

041026-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.557) question?

Stock #

R4195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3202392-3244588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3243186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 675 (V675A)

Ref Sequence

ENSEMBL: ENSMUSP00000112550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]

AlphaFold

Q9EST3

Predicted Effect

probably benign
Transcript: ENSMUST00000020734
AA Change: V826A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: V826A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	688	1.2e-189	PFAM
low complexity region	835	851	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110048
AA Change: V826A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: V826A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	688	1.2e-189	PFAM
low complexity region	835	851	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110049
AA Change: V850A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: V850A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	712	2.7e-184	PFAM
low complexity region	859	875	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120721
AA Change: V675A

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: V675A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	99	3.6e-29	PFAM
Pfam:EIF4E-T	98	327	5.1e-41	PFAM
Pfam:EIF4E-T	282	537	7.7e-30	PFAM
low complexity region	684	700	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127950

Predicted Effect

probably benign
Transcript: ENSMUST00000135223

SMART Domains

Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	1	239	1.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147534

Predicted Effect

probably benign
Transcript: ENSMUST00000159304

SMART Domains

Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

Domain	Start	End	E-Value	Type
Pfam:TGS	13	58	5.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179770
AA Change: V850A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: V850A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	710	4.3e-160	PFAM
low complexity region	859	875	N/A	INTRINSIC

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atl3	A	G	19: 7,518,546	I171V	possibly damaging	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cacna1f	A	G	X: 7,608,930	H57R	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Lman2l	A	C	1: 36,424,941	I266M	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Olfr266	A	T	3: 106,822,012	C182*	probably null	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Eif4enif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Eif4enif1	APN	11	3221143	missense	probably damaging	0.96
IGL02237:Eif4enif1	APN	11	3227876	nonsense	probably null
IGL02372:Eif4enif1	APN	11	3229986	missense	probably benign	0.09
PIT4283001:Eif4enif1	UTSW	11	3234464	missense	probably damaging	1.00
R0079:Eif4enif1	UTSW	11	3242676	nonsense	probably null
R1177:Eif4enif1	UTSW	11	3229902	missense	probably damaging	1.00
R1220:Eif4enif1	UTSW	11	3239493	splice site	probably benign
R1511:Eif4enif1	UTSW	11	3236278	missense	probably benign	0.00
R1675:Eif4enif1	UTSW	11	3215686	missense	probably benign	0.02
R1908:Eif4enif1	UTSW	11	3227455	missense	probably damaging	1.00
R1940:Eif4enif1	UTSW	11	3243279	missense	probably damaging	1.00
R2173:Eif4enif1	UTSW	11	3242367	splice site	probably null
R2215:Eif4enif1	UTSW	11	3227476	missense	probably damaging	1.00
R2517:Eif4enif1	UTSW	11	3221168	missense	probably damaging	1.00
R2869:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2869:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2870:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2870:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2871:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2871:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2873:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R3147:Eif4enif1	UTSW	11	3244003	splice site	probably null
R4196:Eif4enif1	UTSW	11	3243186	missense	possibly damaging	0.89
R4708:Eif4enif1	UTSW	11	3220323	missense	probably damaging	1.00
R4755:Eif4enif1	UTSW	11	3244016	missense	probably damaging	1.00
R5310:Eif4enif1	UTSW	11	3242687	missense	probably damaging	1.00
R5546:Eif4enif1	UTSW	11	3243989	missense	probably damaging	0.99
R5816:Eif4enif1	UTSW	11	3242401	missense	probably benign	0.13
R6018:Eif4enif1	UTSW	11	3242481	missense	probably damaging	0.97
R6036:Eif4enif1	UTSW	11	3239420	missense	probably damaging	1.00
R6036:Eif4enif1	UTSW	11	3239420	missense	probably damaging	1.00
R6267:Eif4enif1	UTSW	11	3227793	missense	probably damaging	1.00
R6514:Eif4enif1	UTSW	11	3240996	missense	probably null	0.01
R6638:Eif4enif1	UTSW	11	3242463	missense	probably damaging	0.96
R7040:Eif4enif1	UTSW	11	3234040	missense	probably benign	0.33
R7232:Eif4enif1	UTSW	11	3215678	missense	possibly damaging	0.75
R7385:Eif4enif1	UTSW	11	3220269	missense	probably damaging	1.00
R7478:Eif4enif1	UTSW	11	3227709	nonsense	probably null
R7749:Eif4enif1	UTSW	11	3242608	missense	probably damaging	0.99
R8381:Eif4enif1	UTSW	11	3227470	missense	probably damaging	1.00
R9029:Eif4enif1	UTSW	11	3224716	missense	probably damaging	1.00
R9622:Eif4enif1	UTSW	11	3215714	missense	probably benign	0.26
R9646:Eif4enif1	UTSW	11	3220280	missense	probably damaging	1.00
R9694:Eif4enif1	UTSW	11	3220384	missense	probably damaging	0.98
R9747:Eif4enif1	UTSW	11	3213267	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGAGTCCAATCCAGTCTCAC -3'
(R):5'- AACCTTACCTGAGCGCTGTAG -3'

Sequencing Primer
(F):5'- TACACTAAGGAACCCTGGCTGTG -3'
(R):5'- GGTTTAGGAGAGGGTGACTA -3'

Posted On

2015-06-10