Incidental Mutation 'R4195:Fbll1'
ID318538
Institutional Source Beutler Lab
Gene Symbol Fbll1
Ensembl Gene ENSMUSG00000051062
Gene Namefibrillarin-like 1
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4195 (G1)
Quality Score222
Status Validated
Chromosome11
Chromosomal Location35797382-35798884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35797872 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 188 (H188L)
Ref Sequence ENSEMBL: ENSMUSP00000128889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160726]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120504
Predicted Effect possibly damaging
Transcript: ENSMUST00000160726
AA Change: H188L

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128889
Gene: ENSMUSG00000051062
AA Change: H188L

DomainStartEndE-ValueType
low complexity region 5 77 N/A INTRINSIC
Fibrillarin 82 309 1.21e-170 SMART
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Fbll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Fbll1 APN 11 35798047 missense probably benign 0.00
IGL01559:Fbll1 APN 11 35797545 missense probably damaging 1.00
IGL01663:Fbll1 APN 11 35797821 missense probably damaging 1.00
IGL01799:Fbll1 APN 11 35798109 missense possibly damaging 0.71
IGL01988:Fbll1 APN 11 35797901 missense probably benign
R0088:Fbll1 UTSW 11 35798140 missense possibly damaging 0.72
R3087:Fbll1 UTSW 11 35798190 missense probably damaging 1.00
R3738:Fbll1 UTSW 11 35797678 missense possibly damaging 0.88
R3739:Fbll1 UTSW 11 35797678 missense possibly damaging 0.88
R3854:Fbll1 UTSW 11 35797699 missense probably benign 0.01
R3935:Fbll1 UTSW 11 35797648 missense probably damaging 1.00
R4034:Fbll1 UTSW 11 35797678 missense possibly damaging 0.88
R4195:Fbll1 UTSW 11 35797666 missense possibly damaging 0.93
R4196:Fbll1 UTSW 11 35797872 missense possibly damaging 0.75
R4824:Fbll1 UTSW 11 35797825 missense probably damaging 1.00
R4923:Fbll1 UTSW 11 35797580 missense probably benign 0.02
R5669:Fbll1 UTSW 11 35797584 missense probably benign 0.09
R5909:Fbll1 UTSW 11 35798332 missense unknown
R6265:Fbll1 UTSW 11 35797809 missense probably damaging 0.98
R8078:Fbll1 UTSW 11 35797901 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCGATGCAGTTGGCCTTG -3'
(R):5'- GAATCCCTTCCGCTCCAAATTG -3'

Sequencing Primer
(F):5'- AGAAAGTGGCCTCCGTTG -3'
(R):5'- TCCGCTCCAAATTGGCAGC -3'
Posted On2015-06-10