Incidental Mutation 'R4195:Apod'
ID318542
Institutional Source Beutler Lab
Gene Symbol Apod
Ensembl Gene ENSMUSG00000022548
Gene Nameapolipoprotein D
Synonyms
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R4195 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location31296192-31314808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31297574 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 113 (M113V)
Ref Sequence ENSEMBL: ENSMUSP00000119827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115230] [ENSMUST00000130560]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023207
Predicted Effect probably benign
Transcript: ENSMUST00000115230
AA Change: M113V

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110885
Gene: ENSMUSG00000022548
AA Change: M113V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin_2 37 182 3.8e-29 PFAM
Pfam:Lipocalin 43 184 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130560
AA Change: M113V

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119827
Gene: ENSMUSG00000022548
AA Change: M113V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Lipocalin_2 37 182 3.8e-29 PFAM
Pfam:Lipocalin 43 184 2.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229200
Meta Mutation Damage Score 0.1590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of high-density lipoprotein (HDL), but is unique in that it shares greater structural similarity to lipocalin than to other members of the apolipoprotein family, and has a wider tissue expression pattern. The encoded protein is involved in lipid metabolism, and ablation of this gene results in defects in triglyceride metabolism. Elevated levels of this gene product have been observed in multiple tissues of Niemann-Pick disease mouse models, as well as in some tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for one null allele display increased sensitivity to reactive oxygen species, impaired motor and spatial learning, and decreased vertical and horizontal activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Apod
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4619:Apod UTSW 16 31297393 missense probably benign 0.38
R4620:Apod UTSW 16 31297393 missense probably benign 0.38
R4757:Apod UTSW 16 31303462 missense probably damaging 1.00
R5290:Apod UTSW 16 31311066 missense probably damaging 0.96
R5363:Apod UTSW 16 31311091 missense probably benign 0.00
R5543:Apod UTSW 16 31303533 critical splice acceptor site probably null
R7054:Apod UTSW 16 31311132 missense probably benign
Z1177:Apod UTSW 16 31297520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGGTACTTAAGAGGCG -3'
(R):5'- GCCAACCACCTGAAAGTTG -3'

Sequencing Primer
(F):5'- TCGATGTCGATGCCATTAGAAG -3'
(R):5'- CCACCTGAAAGTTGGAGCAG -3'
Posted On2015-06-10