Incidental Mutation 'R4195:Cldn9'
ID318544
Institutional Source Beutler Lab
Gene Symbol Cldn9
Ensembl Gene ENSMUSG00000066720
Gene Nameclaudin 9
Synonymsnmf329
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4195 (G1)
Quality Score108
Status Validated
Chromosome17
Chromosomal Location23682584-23684018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23683174 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 159 (E159G)
Ref Sequence ENSEMBL: ENSMUSP00000093236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024699] [ENSMUST00000085989]
Predicted Effect probably benign
Transcript: ENSMUST00000024699
SMART Domains Protein: ENSMUSP00000024699
Gene: ENSMUSG00000023906

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 2.5e-35 PFAM
Pfam:Claudin_2 15 183 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085989
AA Change: E159G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093236
Gene: ENSMUSG00000066720
AA Change: E159G

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 9.7e-35 PFAM
Pfam:Claudin_2 15 183 8.1e-12 PFAM
Meta Mutation Damage Score 0.8900 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is developmentally regulated; it is expressed in neonate kidney, but disappers by adulthood. It is required for the preservation of sensory cells in the hearing organ and the gene deficiency is associated with deafness. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit severe and early hearing loss associated with degeneration of outer hair cells and increased perilymph potassium ion concentration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cacna1f A G X: 7,608,930 H57R probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Cldn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1687:Cldn9 UTSW 17 23683076 missense probably benign 0.00
R5710:Cldn9 UTSW 17 23683447 missense probably damaging 1.00
R6676:Cldn9 UTSW 17 23683049 missense probably benign 0.00
R7007:Cldn9 UTSW 17 23683078 missense probably benign
R7336:Cldn9 UTSW 17 23683015 missense probably benign 0.27
Z1177:Cldn9 UTSW 17 23683201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGAAGAAGCCTCAGCC -3'
(R):5'- GTATACGACTCACTGCTGGC -3'

Sequencing Primer
(F):5'- GCCTCAGCCTCACACATAGTC -3'
(R):5'- AGAGCCCTCTGTGTCGTG -3'
Posted On2015-06-10