Incidental Mutation 'R4195:Cacna1f'
ID318545
Institutional Source Beutler Lab
Gene Symbol Cacna1f
Ensembl Gene ENSMUSG00000031142
Gene Namecalcium channel, voltage-dependent, alpha 1F subunit
SynonymsCav1.4, Sfc17
MMRRC Submission 041026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4195 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location7607083-7635196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7608930 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 57 (H57R)
Ref Sequence ENSEMBL: ENSMUSP00000111390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033483] [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]
Predicted Effect probably benign
Transcript: ENSMUST00000033483
SMART Domains Protein: ENSMUSP00000033483
Gene: ENSMUSG00000031143

DomainStartEndE-ValueType
Pfam:DUF812 1 597 8.4e-216 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115725
AA Change: H57R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142
AA Change: H57R

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115726
AA Change: H57R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142
AA Change: H57R

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126170
Predicted Effect possibly damaging
Transcript: ENSMUST00000133637
AA Change: H57R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142
AA Change: H57R

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 4.8e-59 PFAM
PDB:4DEY|B 372 415 9e-22 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 2.2e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144522
Predicted Effect probably benign
Transcript: ENSMUST00000155090
AA Change: H57R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142
AA Change: H57R

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Actg2 T G 6: 83,523,173 T39P probably damaging Het
Agap1 A G 1: 89,834,539 E531G probably damaging Het
Alox12b A G 11: 69,169,600 S661G probably benign Het
Apod T C 16: 31,297,574 M113V probably benign Het
Atl3 A G 19: 7,518,546 I171V possibly damaging Het
Atrn C A 2: 130,933,412 T145K probably damaging Het
Cldn9 T C 17: 23,683,174 E159G probably damaging Het
Cnnm4 C A 1: 36,499,508 H590Q probably benign Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Cse1l A G 2: 166,929,979 T387A probably damaging Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Fbll1 A G 11: 35,797,666 S257P possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
G3bp2 A G 5: 92,055,416 S349P probably damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gm281 C A 14: 13,829,772 V657L probably benign Het
Gm6569 C T 15: 73,836,243 P22L probably damaging Het
Itih2 T C 2: 10,115,285 N314D probably damaging Het
Lman2l A C 1: 36,424,941 I266M probably damaging Het
Mrps9 T G 1: 42,901,094 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Neb G T 2: 52,271,559 R2074S probably damaging Het
Neb A T 2: 52,290,835 H1226Q probably damaging Het
Nmi A C 2: 51,948,620 S301A probably benign Het
Olfr266 A T 3: 106,822,012 C182* probably null Het
Pclo A G 5: 14,677,563 probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Polr1e T C 4: 45,019,327 Y59H probably damaging Het
Slc30a4 G A 2: 122,685,270 T401M probably damaging Het
Tas1r3 T C 4: 155,862,985 E81G probably damaging Het
Zfp990 A T 4: 145,536,977 probably null Het
Zzz3 A G 3: 152,428,465 T387A probably benign Het
Other mutations in Cacna1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Cacna1f APN X 7631031 missense probably damaging 1.00
IGL01693:Cacna1f APN X 7625367 missense probably damaging 1.00
IGL02143:Cacna1f APN X 7613995 intron probably benign
IGL02167:Cacna1f APN X 7616019 missense probably damaging 1.00
IGL02381:Cacna1f APN X 7616068 missense probably damaging 1.00
IGL02466:Cacna1f APN X 7629405 splice site probably null
IGL03006:Cacna1f APN X 7626903 missense probably damaging 1.00
FR4304:Cacna1f UTSW X 7620061 utr 3 prime probably benign
FR4340:Cacna1f UTSW X 7620067 utr 3 prime probably benign
FR4548:Cacna1f UTSW X 7620058 utr 3 prime probably benign
R0629:Cacna1f UTSW X 7620434 missense probably damaging 0.99
R1791:Cacna1f UTSW X 7620439 missense probably damaging 0.99
R2507:Cacna1f UTSW X 7626448 splice site probably null
R2508:Cacna1f UTSW X 7626448 splice site probably null
R4365:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R4366:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R8111:Cacna1f UTSW X 7621087 missense probably damaging 1.00
RF011:Cacna1f UTSW X 7620056 utr 3 prime probably benign
RF025:Cacna1f UTSW X 7620057 nonsense probably null
RF026:Cacna1f UTSW X 7620075 nonsense probably null
RF027:Cacna1f UTSW X 7620054 nonsense probably null
RF028:Cacna1f UTSW X 7620060 utr 3 prime probably benign
RF028:Cacna1f UTSW X 7620063 utr 3 prime probably benign
RF032:Cacna1f UTSW X 7620063 nonsense probably null
RF035:Cacna1f UTSW X 7620054 nonsense probably null
RF040:Cacna1f UTSW X 7618971 frame shift probably null
RF044:Cacna1f UTSW X 7620057 nonsense probably null
RF056:Cacna1f UTSW X 7620075 nonsense probably null
RF060:Cacna1f UTSW X 7620060 utr 3 prime probably benign
Z1088:Cacna1f UTSW X 7610251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCCCATCAAATACAGGGATG -3'
(R):5'- CCAGTCCAGGCTTGACTTAAC -3'

Sequencing Primer
(F):5'- CTGGACAAGAAATGGCTATGATTGTC -3'
(R):5'- AGTCCAGGCTTGACTTAACTCTAGAC -3'
Posted On2015-06-10