Mutagenetix > Incidental Mutation

Incidental Mutation 'R4195:Cacna1f'

318545

Institutional Source

Beutler Lab

Gene Symbol

Cacna1f

Ensembl Gene

ENSMUSG00000031142

Gene Name

calcium channel, voltage-dependent, alpha 1F subunit

Synonyms

Cav1.4, Sfc17

MMRRC Submission

041026-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4195 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

7607083-7635196 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7608930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 57 (H57R)

Ref Sequence

ENSEMBL: ENSMUSP00000111390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033483] [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000033483

SMART Domains

Protein: ENSMUSP00000033483
Gene: ENSMUSG00000031143

Domain	Start	End	E-Value	Type
Pfam:DUF812	1	597	8.4e-216	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115725
AA Change: H57R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142
AA Change: H57R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	129	371	9.3e-59	PFAM
PDB:4DEY\|B	372	415	2e-21	PDB
low complexity region	455	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
transmembrane domain	525	547	N/A	INTRINSIC
Pfam:Ion_trans	563	757	3.8e-44	PFAM
coiled coil region	806	834	N/A	INTRINSIC
Pfam:Ion_trans	909	1139	1.1e-50	PFAM
Pfam:Ion_trans	1227	1436	2.7e-64	PFAM
Pfam:PKD_channel	1272	1443	1e-10	PFAM
Blast:EFh	1457	1485	2e-8	BLAST
Ca_chan_IQ	1571	1605	3.71e-14	SMART
low complexity region	1636	1655	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115726
AA Change: H57R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142
AA Change: H57R

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	91	383	2.1e-70	PFAM
low complexity region	455	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
Pfam:Ion_trans	528	768	3.8e-54	PFAM
coiled coil region	806	834	N/A	INTRINSIC
Pfam:Ion_trans	873	1151	2.4e-59	PFAM
Pfam:Ion_trans	1192	1455	2.6e-67	PFAM
Pfam:PKD_channel	1285	1450	8.5e-10	PFAM
Pfam:GPHH	1457	1526	2.7e-37	PFAM
Ca_chan_IQ	1578	1612	3.71e-14	SMART
Pfam:CAC1F_C	1622	1983	1.5e-164	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126170

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133637
AA Change: H57R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142
AA Change: H57R

Domain	Start	End	E-Value	Type
transmembrane domain	96	115	N/A	INTRINSIC
Pfam:Ion_trans	129	371	4.8e-59	PFAM
PDB:4DEY\|B	372	415	9e-22	PDB
low complexity region	455	469	N/A	INTRINSIC
low complexity region	479	491	N/A	INTRINSIC
transmembrane domain	525	547	N/A	INTRINSIC
Pfam:Ion_trans	563	757	2.2e-44	PFAM
low complexity region	822	832	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141634

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144522

Predicted Effect

probably benign
Transcript: ENSMUST00000155090
AA Change: H57R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142
AA Change: H57R

Domain	Start	End	E-Value	Type
transmembrane domain	96	115	N/A	INTRINSIC
Pfam:Ion_trans	129	371	1.1e-59	PFAM
PDB:4DEY\|B	372	415	4e-22	PDB

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Actg2	T	G	6: 83,523,173	T39P	probably damaging	Het
Agap1	A	G	1: 89,834,539	E531G	probably damaging	Het
Alox12b	A	G	11: 69,169,600	S661G	probably benign	Het
Apod	T	C	16: 31,297,574	M113V	probably benign	Het
Atl3	A	G	19: 7,518,546	I171V	possibly damaging	Het
Atrn	C	A	2: 130,933,412	T145K	probably damaging	Het
Cldn9	T	C	17: 23,683,174	E159G	probably damaging	Het
Cnnm4	C	A	1: 36,499,508	H590Q	probably benign	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Cse1l	A	G	2: 166,929,979	T387A	probably damaging	Het
Eif4enif1	T	C	11: 3,243,186	V675A	possibly damaging	Het
Fbll1	A	G	11: 35,797,666	S257P	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
G3bp2	A	G	5: 92,055,416	S349P	probably damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gm281	C	A	14: 13,829,772	V657L	probably benign	Het
Gm6569	C	T	15: 73,836,243	P22L	probably damaging	Het
Itih2	T	C	2: 10,115,285	N314D	probably damaging	Het
Lman2l	A	C	1: 36,424,941	I266M	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Neb	G	T	2: 52,271,559	R2074S	probably damaging	Het
Neb	A	T	2: 52,290,835	H1226Q	probably damaging	Het
Nmi	A	C	2: 51,948,620	S301A	probably benign	Het
Olfr266	A	T	3: 106,822,012	C182*	probably null	Het
Pclo	A	G	5: 14,677,563		probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Polr1e	T	C	4: 45,019,327	Y59H	probably damaging	Het
Slc30a4	G	A	2: 122,685,270	T401M	probably damaging	Het
Tas1r3	T	C	4: 155,862,985	E81G	probably damaging	Het
Zfp990	A	T	4: 145,536,977		probably null	Het
Zzz3	A	G	3: 152,428,465	T387A	probably benign	Het

Other mutations in Cacna1f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Cacna1f	APN	X	7631031	missense	probably damaging	1.00
IGL01693:Cacna1f	APN	X	7625367	missense	probably damaging	1.00
IGL02143:Cacna1f	APN	X	7613995	intron	probably benign
IGL02167:Cacna1f	APN	X	7616019	missense	probably damaging	1.00
IGL02381:Cacna1f	APN	X	7616068	missense	probably damaging	1.00
IGL02466:Cacna1f	APN	X	7629405	splice site	probably null
IGL03006:Cacna1f	APN	X	7626903	missense	probably damaging	1.00
FR4304:Cacna1f	UTSW	X	7620061	utr 3 prime	probably benign
FR4340:Cacna1f	UTSW	X	7620067	utr 3 prime	probably benign
FR4548:Cacna1f	UTSW	X	7620058	utr 3 prime	probably benign
R0629:Cacna1f	UTSW	X	7620434	missense	probably damaging	0.99
R1791:Cacna1f	UTSW	X	7620439	missense	probably damaging	0.99
R2507:Cacna1f	UTSW	X	7626448	splice site	probably null
R2508:Cacna1f	UTSW	X	7626448	splice site	probably null
R4365:Cacna1f	UTSW	X	7609974	missense	probably damaging	1.00
R4366:Cacna1f	UTSW	X	7609974	missense	probably damaging	1.00
R8111:Cacna1f	UTSW	X	7621087	missense	probably damaging	1.00
RF011:Cacna1f	UTSW	X	7620056	utr 3 prime	probably benign
RF025:Cacna1f	UTSW	X	7620057	nonsense	probably null
RF026:Cacna1f	UTSW	X	7620075	nonsense	probably null
RF027:Cacna1f	UTSW	X	7620054	nonsense	probably null
RF028:Cacna1f	UTSW	X	7620060	utr 3 prime	probably benign
RF028:Cacna1f	UTSW	X	7620063	utr 3 prime	probably benign
RF032:Cacna1f	UTSW	X	7620063	nonsense	probably null
RF035:Cacna1f	UTSW	X	7620054	nonsense	probably null
RF040:Cacna1f	UTSW	X	7618971	frame shift	probably null
RF044:Cacna1f	UTSW	X	7620057	nonsense	probably null
RF056:Cacna1f	UTSW	X	7620075	nonsense	probably null
RF060:Cacna1f	UTSW	X	7620060	utr 3 prime	probably benign
Z1088:Cacna1f	UTSW	X	7610251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCTCCCATCAAATACAGGGATG -3'
(R):5'- CCAGTCCAGGCTTGACTTAAC -3'

Sequencing Primer
(F):5'- CTGGACAAGAAATGGCTATGATTGTC -3'
(R):5'- AGTCCAGGCTTGACTTAACTCTAGAC -3'

Posted On

2015-06-10